ID: 1191805977

View in Genome Browser
Species Human (GRCh38)
Location X:65134212-65134234
Sequence CTCACACACATTGCAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191805977_1191805983 27 Left 1191805977 X:65134212-65134234 CCCTGGGCTGCAATGTGTGTGAG No data
Right 1191805983 X:65134262-65134284 ACTTGCCACCAAGAGAACGTGGG No data
1191805977_1191805982 26 Left 1191805977 X:65134212-65134234 CCCTGGGCTGCAATGTGTGTGAG No data
Right 1191805982 X:65134261-65134283 GACTTGCCACCAAGAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191805977 Original CRISPR CTCACACACATTGCAGCCCA GGG (reversed) Intergenic
No off target data available for this crispr