ID: 1191805978

View in Genome Browser
Species Human (GRCh38)
Location X:65134213-65134235
Sequence GCTCACACACATTGCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191805978_1191805982 25 Left 1191805978 X:65134213-65134235 CCTGGGCTGCAATGTGTGTGAGC No data
Right 1191805982 X:65134261-65134283 GACTTGCCACCAAGAGAACGTGG No data
1191805978_1191805983 26 Left 1191805978 X:65134213-65134235 CCTGGGCTGCAATGTGTGTGAGC No data
Right 1191805983 X:65134262-65134284 ACTTGCCACCAAGAGAACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191805978 Original CRISPR GCTCACACACATTGCAGCCC AGG (reversed) Intergenic
No off target data available for this crispr