ID: 1191805979

View in Genome Browser
Species Human (GRCh38)
Location X:65134238-65134260
Sequence AATTGCTGGGATGCTTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191805979_1191805983 1 Left 1191805979 X:65134238-65134260 CCAAAGCAAGCATCCCAGCAATT No data
Right 1191805983 X:65134262-65134284 ACTTGCCACCAAGAGAACGTGGG No data
1191805979_1191805982 0 Left 1191805979 X:65134238-65134260 CCAAAGCAAGCATCCCAGCAATT No data
Right 1191805982 X:65134261-65134283 GACTTGCCACCAAGAGAACGTGG No data
1191805979_1191805986 14 Left 1191805979 X:65134238-65134260 CCAAAGCAAGCATCCCAGCAATT No data
Right 1191805986 X:65134275-65134297 AGAACGTGGGTGAATGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191805979 Original CRISPR AATTGCTGGGATGCTTGCTT TGG (reversed) Intergenic
No off target data available for this crispr