ID: 1191805982

View in Genome Browser
Species Human (GRCh38)
Location X:65134261-65134283
Sequence GACTTGCCACCAAGAGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191805978_1191805982 25 Left 1191805978 X:65134213-65134235 CCTGGGCTGCAATGTGTGTGAGC No data
Right 1191805982 X:65134261-65134283 GACTTGCCACCAAGAGAACGTGG No data
1191805977_1191805982 26 Left 1191805977 X:65134212-65134234 CCCTGGGCTGCAATGTGTGTGAG No data
Right 1191805982 X:65134261-65134283 GACTTGCCACCAAGAGAACGTGG No data
1191805979_1191805982 0 Left 1191805979 X:65134238-65134260 CCAAAGCAAGCATCCCAGCAATT No data
Right 1191805982 X:65134261-65134283 GACTTGCCACCAAGAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191805982 Original CRISPR GACTTGCCACCAAGAGAACG TGG Intergenic
No off target data available for this crispr