ID: 1191809865

View in Genome Browser
Species Human (GRCh38)
Location X:65175174-65175196
Sequence GAGGGTAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3016
Summary {0: 7, 1: 218, 2: 640, 3: 931, 4: 1220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191809865 Original CRISPR GAGGGTAAGCAGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr