ID: 1191812497

View in Genome Browser
Species Human (GRCh38)
Location X:65204037-65204059
Sequence AGAGAGAACACAATGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191812497_1191812506 29 Left 1191812497 X:65204037-65204059 CCCACAATCATTGTGTTCTCTCT No data
Right 1191812506 X:65204089-65204111 CTGTGGCTGCTGCCAGGATATGG No data
1191812497_1191812502 23 Left 1191812497 X:65204037-65204059 CCCACAATCATTGTGTTCTCTCT No data
Right 1191812502 X:65204083-65204105 TATCCCCTGTGGCTGCTGCCAGG No data
1191812497_1191812501 12 Left 1191812497 X:65204037-65204059 CCCACAATCATTGTGTTCTCTCT No data
Right 1191812501 X:65204072-65204094 CATTCTCTCTCTATCCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191812497 Original CRISPR AGAGAGAACACAATGATTGT GGG (reversed) Intergenic
No off target data available for this crispr