ID: 1191813352

View in Genome Browser
Species Human (GRCh38)
Location X:65216317-65216339
Sequence AGAGAGAGCGTAGTGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191813346_1191813352 26 Left 1191813346 X:65216268-65216290 CCCAATCCTAGGCAGTCAAGCAC No data
Right 1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG No data
1191813345_1191813352 27 Left 1191813345 X:65216267-65216289 CCCCAATCCTAGGCAGTCAAGCA No data
Right 1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG No data
1191813347_1191813352 25 Left 1191813347 X:65216269-65216291 CCAATCCTAGGCAGTCAAGCACT No data
Right 1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG No data
1191813348_1191813352 20 Left 1191813348 X:65216274-65216296 CCTAGGCAGTCAAGCACTGAGAG No data
Right 1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191813352 Original CRISPR AGAGAGAGCGTAGTGAGTGT GGG Intergenic
No off target data available for this crispr