ID: 1191824779

View in Genome Browser
Species Human (GRCh38)
Location X:65353106-65353128
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191824779_1191824782 4 Left 1191824779 X:65353106-65353128 CCGGCCTCCTTCTTAGTGCTCAG No data
Right 1191824782 X:65353133-65353155 CAGACATGATCCACTGTGTGTGG No data
1191824779_1191824783 5 Left 1191824779 X:65353106-65353128 CCGGCCTCCTTCTTAGTGCTCAG No data
Right 1191824783 X:65353134-65353156 AGACATGATCCACTGTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191824779 Original CRISPR CTGAGCACTAAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr