ID: 1191826405

View in Genome Browser
Species Human (GRCh38)
Location X:65370072-65370094
Sequence TTCTTTTTCAATATAGACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191826405_1191826408 22 Left 1191826405 X:65370072-65370094 CCCTCGTCTATATTGAAAAAGAA 0: 1
1: 0
2: 1
3: 22
4: 251
Right 1191826408 X:65370117-65370139 ATTCATATAGTTTCGAAGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191826405 Original CRISPR TTCTTTTTCAATATAGACGA GGG (reversed) Intronic
904072394 1:27811507-27811529 TTGTTTTTTAATAGAGATGAGGG + Intronic
907331694 1:53676032-53676054 TTCTTCTTCAAAATAAAAGAGGG - Intronic
908162346 1:61422732-61422754 TTTTTTTTAAATAGAGACGGGGG - Intronic
910469104 1:87531757-87531779 GTCTGATTCAATATAGACCAAGG + Intergenic
910985020 1:92996876-92996898 TTTTTTTTCAATAAGGCCGATGG - Intergenic
911521841 1:98939276-98939298 TAATTTTTCCATATAGAGGAAGG + Intronic
912500370 1:110117897-110117919 CTCATTTTCAAAATAGAAGAAGG + Intergenic
913469510 1:119174689-119174711 TTCTTTTTCATTAAAGGCCAGGG - Intergenic
915962233 1:160276553-160276575 TTATTTTTTAATAAAGACAATGG - Intergenic
916103614 1:161413666-161413688 TTTTTTTTTAATAGAGATGAGGG - Intergenic
916426270 1:164683758-164683780 TTTTTTTTCAGTATTGATGAGGG + Intronic
917858271 1:179120084-179120106 TTCTTTTTAAATATAGAGACAGG - Intronic
918678812 1:187325457-187325479 TGCTTTTCCAATATAGAAGTTGG + Intergenic
919398393 1:197079579-197079601 TTTTTTTTCAATATATATGTTGG - Intergenic
920607658 1:207405435-207405457 TTTTTTTTTAGTAGAGACGAGGG + Intergenic
922302815 1:224317919-224317941 TCTTTTTTCAGTATAGACTATGG - Exonic
923152776 1:231248553-231248575 TTTTTTTTCAATAGAGACGGGGG - Intronic
923583104 1:235237630-235237652 TTCTTTTTCATTTGAGACCATGG + Intronic
1063670359 10:8095220-8095242 TTTTTTTTTAATAGAGACAAGGG - Intergenic
1064202118 10:13293637-13293659 TTTTTTTCCAATATAGACAATGG + Intronic
1065155276 10:22863197-22863219 TTCTTTTTTAATTTAAAGGAAGG - Intergenic
1065681586 10:28239317-28239339 TTTTTTTTTAATAGAGACGGGGG + Intronic
1066270745 10:33820298-33820320 TTCTTTTTTAGTAGAGACGGGGG + Intergenic
1066467369 10:35665136-35665158 TTGTTTTTAACTATATACGAGGG + Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1067366545 10:45635970-45635992 TTCTTTTCCAATATACAGTAAGG - Intronic
1068651057 10:59523062-59523084 TGCTATTTCAATATAAACAACGG - Intergenic
1069062468 10:63908432-63908454 TTCTTTTTAAAAATACAGGAGGG + Intergenic
1070178485 10:73992980-73993002 TTTTTTTTCAATAGAGACAAGGG - Intergenic
1070241936 10:74690580-74690602 TTATTTTGCAATATAGTCAAAGG - Intronic
1071940594 10:90587426-90587448 TTCTTTTTCAGTCTAGAGGCTGG - Intergenic
1073158329 10:101367370-101367392 TTCTTCTTAAATATAGACCTAGG - Intronic
1073862742 10:107766327-107766349 TTATTTTTAAATCTACACGAGGG + Intergenic
1074035636 10:109735447-109735469 TTCTTTTTCATCATTGACTATGG - Intergenic
1074206552 10:111287806-111287828 TTCTTTTTAAGAATAGAAGAGGG - Intergenic
1076153813 10:128187447-128187469 TTCTTTATCAAGATAGAGCAGGG - Intergenic
1076301199 10:129427830-129427852 TTCTTTTTCACTATAGTCAATGG - Intergenic
1077974277 11:7231569-7231591 TTCTTTGTCCATCTAGACAAAGG - Intergenic
1080582173 11:33652689-33652711 TTCTTTCCCAAAATAGACAAAGG - Intronic
1080675903 11:34426699-34426721 TTCTTTTTTTAAATTGACGAAGG + Intergenic
1080993030 11:37563497-37563519 ATCTTTCTCAATATTGATGATGG + Intergenic
1084007080 11:66328858-66328880 TTCTTTTTCCATAAGGACAAAGG + Intergenic
1084988738 11:72902784-72902806 TTATTTTTCATTTTAGACAATGG + Intronic
1086076026 11:82853615-82853637 TTATTTTTAAATAAGGACGAGGG + Intronic
1086372273 11:86166834-86166856 TTCTTTTTCAAAAAGGAAGAAGG + Intergenic
1087283247 11:96235756-96235778 TTCTTTTTCAATGTAAACCAGGG + Intronic
1088205707 11:107389859-107389881 TTGTTTTTAAATATAGACTGTGG - Intronic
1088621843 11:111692882-111692904 TTCAATTTCAATATACAAGATGG - Intronic
1088790221 11:113218550-113218572 TTCTTGTTCATTATAAAAGAAGG + Intronic
1091341366 11:134817687-134817709 TTTTTTTGCAACATAGAGGAAGG + Intergenic
1093352363 12:18119081-18119103 TAAATTTTCAATATAGAGGAAGG + Intronic
1095581361 12:43804104-43804126 TTGTTTTTAAATATAAACAAAGG - Intronic
1095684952 12:45022966-45022988 TTCTTTTTCCATTTAGAAAACGG + Intronic
1097362376 12:58671950-58671972 TCCTTTTTCCATGAAGACGAAGG - Intronic
1098458261 12:70701317-70701339 TTCTTCTCCAATGTAGAAGAGGG - Exonic
1098786859 12:74770033-74770055 TTCTTTTTCCATATACACTATGG + Intergenic
1098839413 12:75460855-75460877 TTTTTATTCAATATTGACGTTGG - Intergenic
1100387560 12:94118045-94118067 TTTATTTTTAATAGAGACGAGGG - Intergenic
1101933400 12:109034552-109034574 TTCTTTTTTAATAGAGATGGGGG - Intronic
1102335854 12:112079410-112079432 TTATTTTTCAGTAGAGACGGGGG - Intronic
1102543233 12:113637492-113637514 TTCTTTTTTAATATATGAGAAGG + Intergenic
1103310157 12:119999796-119999818 TTTATTTTCAATATACAAGAAGG - Intronic
1103732377 12:123036509-123036531 TTCTTTTTTAATAGAGAGGAGGG - Intronic
1105955746 13:25281152-25281174 TTCTTTTTCTGTAGAGATGAGGG - Intronic
1106564609 13:30873367-30873389 TTTTTTTTCAATAGAGACTGGGG + Intergenic
1106612463 13:31296656-31296678 CTATTTTTCAATAGAGATGATGG + Intronic
1106634734 13:31516024-31516046 TTCTTTTTCAAAATGTACGTAGG + Intergenic
1106928210 13:34635035-34635057 TTCTTTTTCAGATTAGAGGAAGG - Intergenic
1107715552 13:43195979-43196001 TTCTTTGACAATATAAAAGAAGG + Intergenic
1112270834 13:97967957-97967979 ATTTTTTTCAATATAGAGAAGGG + Intronic
1112805445 13:103159630-103159652 TTCTTTTTTCATTTAGACCAGGG + Intergenic
1114668124 14:24393137-24393159 TTCTTTTTAATTAAAGACAAAGG + Intergenic
1116412050 14:44635812-44635834 TTATTATTCAATCTAGACAAGGG + Intergenic
1116882604 14:50186606-50186628 TTTTTTTTAAATATAGATGGGGG - Intronic
1117926418 14:60784349-60784371 TTTTTTTTAAATAGAGATGAGGG + Intronic
1120129655 14:80790268-80790290 TTCTTTTTTAATATGGATAATGG - Intronic
1121723060 14:96125288-96125310 TTATTTTTCAATATACGCTATGG + Intergenic
1121959693 14:98247894-98247916 TACTTTTTCAATACTCACGAAGG + Intergenic
1123887397 15:24740185-24740207 TTCTTTTTAAATATACAGCATGG - Intergenic
1124406595 15:29398412-29398434 TTCTTTTTTAAAAGAGAGGATGG - Intronic
1125089643 15:35775175-35775197 TTCTTTTTCAAAAAAGATTATGG - Intergenic
1125691093 15:41596808-41596830 TTTTTTTTTAATAAAGATGAGGG + Intergenic
1127289627 15:57558365-57558387 TTATTTTTCTATATAGAATAAGG + Intergenic
1130548642 15:84874834-84874856 TACTTTTTAAAGCTAGACGATGG - Intergenic
1132610887 16:815806-815828 TTTTTTTTTGATAGAGACGAGGG + Intergenic
1134179736 16:12037777-12037799 TTTTTTTTCTGTAGAGACGAGGG - Intronic
1136529179 16:30855749-30855771 TTCTTTTTAAATAGAGACAGGGG - Intronic
1136542909 16:30938340-30938362 TTCTTTTTTAATAGAGATGGGGG - Intronic
1138031180 16:53560586-53560608 TTTTTTTTAAATAGAGACAAGGG + Intergenic
1140767430 16:78173467-78173489 TTTTTTTTTAATGTAGAGGAAGG + Intronic
1141276433 16:82592736-82592758 TTCCTTTTCAATAGACACTATGG + Intergenic
1141455986 16:84142616-84142638 TTCTTTTTTAGTAGAGACGGGGG + Intronic
1142179566 16:88661394-88661416 TTTTTTTTCAGTAGAGACGGGGG + Intronic
1142566283 17:842262-842284 TTCTTTTTCAAAATGGGAGATGG + Intronic
1143594867 17:7907986-7908008 TTCATGTTCAATATCGCCGATGG + Exonic
1146622845 17:34413273-34413295 TTCTTTATCAATATCCAGGAAGG - Intergenic
1146952174 17:36914375-36914397 TTCTTTTTAAAGATAGAGGTGGG - Intergenic
1150586781 17:66525851-66525873 TTTTTTTTCAATTCAGAAGAAGG + Intronic
1152500526 17:80705705-80705727 TTATTTTTCAGTAGAGACGAGGG + Intronic
1153305501 18:3627111-3627133 TTTTTTTTTAATAGAGATGAGGG + Intronic
1155924038 18:31634664-31634686 TTCTAGTTAAATATAGAGGATGG - Intronic
1156991127 18:43408775-43408797 TTCTTTTTGAACATAGAATATGG - Intergenic
1157247651 18:46068693-46068715 TTCTTTTTCAATACAGAGATTGG - Intronic
1161693774 19:5753693-5753715 TTTTTTTTTAATAGAGACAAGGG - Intronic
1162498774 19:11039046-11039068 TTTTTTTTTAATAGAGACAAAGG - Intronic
1162697943 19:12491317-12491339 TGTTTTTTGAATAGAGACGAGGG - Intronic
1163090338 19:15015011-15015033 TTATTTTAAAATATAGATGAGGG - Intronic
1166079150 19:40432952-40432974 TTTTTTTTTAATAGAGACGAGGG + Intergenic
1166552843 19:43678119-43678141 TTTTTTTTTAATAGAGACGGTGG + Intergenic
1166831196 19:45640726-45640748 TTCATTTTTAGTAAAGACGAGGG + Intronic
1167614610 19:50525590-50525612 TTTTTTTTTAGTAGAGACGAGGG + Intronic
1167964955 19:53136559-53136581 TTCTTTTTCTTTTTAGACGTGGG - Intronic
1168322856 19:55520714-55520736 TTCTTTTTTAATAAAGATGGGGG - Intergenic
1168377770 19:55894781-55894803 TTCTTTTTCAATACCGACTCTGG - Intronic
926447808 2:12965516-12965538 TTCCTTTTTAATAGAGACCAGGG - Intergenic
927549395 2:23984281-23984303 TTCTTTTTCATTATAACCTAAGG + Intronic
929182811 2:39061686-39061708 TTCTTTTTAAAAATACATGAAGG - Intronic
929542606 2:42833994-42834016 TTTTTTTTAAATAGAGACGGGGG + Intergenic
930351457 2:50260977-50260999 TTCTTTTTCAATTGAAAAGAAGG - Intronic
930373002 2:50528406-50528428 CTCTTTTTCCATATAGAGGTAGG + Intronic
930377479 2:50586201-50586223 TTCTTCCTCAATATAGCCAAAGG + Intronic
931768449 2:65477357-65477379 ATCTTTTAAAATATAGACAAAGG - Intergenic
931863748 2:66387349-66387371 TTCTTTTTCCATATACATAAGGG - Intergenic
932516417 2:72354701-72354723 TTCTTTTTGACTACAGATGATGG - Intronic
933903581 2:86867173-86867195 TTCTTTTTTAATAGAGATGGGGG - Intergenic
935776934 2:106481791-106481813 TTCTTTTTTAATAGAGATGGGGG + Intergenic
939743029 2:145933957-145933979 TTTTTTTTCAACATAGACTTAGG + Intergenic
940162413 2:150727266-150727288 TTTTTTTTAAATATAGACTCTGG - Intergenic
940806461 2:158192848-158192870 TTTTTTTTCTATTTAGACCATGG - Intronic
941281082 2:163551614-163551636 CTCTTTTTCAAGAAAGACCAAGG - Intergenic
943089895 2:183361566-183361588 TTATTTTTCAATATATTCAATGG + Intergenic
943464236 2:188208803-188208825 TTCTTTGGCAATACAGAAGAAGG - Intergenic
943908212 2:193528474-193528496 TTTTTTTTCAATAGAGACAGGGG - Intergenic
944309963 2:198222664-198222686 TTCTTTTTCAAGATACACAATGG + Intronic
944381487 2:199115734-199115756 TTCCTGATCAATATAGACAAAGG - Intergenic
947154005 2:227142814-227142836 TTGTTTTTCAAAAAAGAAGATGG - Intronic
947326379 2:228982983-228983005 TTCTTTTGCAAAATAGACAAGGG + Intronic
948697549 2:239740208-239740230 TTCTTTTTCAGCATAGAACATGG - Intergenic
1168733986 20:114608-114630 ATCTTTTTAAATATAGGTGATGG - Intergenic
1169103691 20:2975425-2975447 ATGTTTTTTAATATAGACTATGG + Intronic
1170301032 20:14884762-14884784 TTCTGTTTCAATATTAACGCTGG - Intronic
1170331902 20:15221685-15221707 TTCTTTTTTAATATAGAGGATGG + Intronic
1173517707 20:43676920-43676942 TTGTTTTTAAATAGAGAAGAGGG + Intronic
1175469002 20:59212470-59212492 TTCTTTTTAAATATCAACTAAGG + Intronic
1175567111 20:59989081-59989103 TTCATTGTCAATAAAGAGGAGGG + Exonic
1177371309 21:20207392-20207414 ATCTTTTTCAAAATAGACTTTGG + Intergenic
1178516066 21:33248333-33248355 TTCTTTTTTAATGTAGACATAGG - Intronic
1181734915 22:24874119-24874141 TTCTTCTGCAAAATAGAAGAGGG + Intronic
951016702 3:17740142-17740164 TTCTTTTTTAGTAGAGACGGAGG - Intronic
951726292 3:25764454-25764476 TTCTTTTTAAATACAGCCTAAGG + Intronic
953726630 3:45405122-45405144 TTCTTTTTCTTTATACAAGATGG + Intronic
955934754 3:64091904-64091926 TTCTTTTTCCATAGAGACGGAGG + Intergenic
956561582 3:70582854-70582876 TTATTTTTAAATACAGACAAAGG - Intergenic
958205978 3:90393253-90393275 TCCTTTTCCAAAATAGACAAGGG + Intergenic
959671986 3:108989095-108989117 TTCTATTACAATATAGTTGAGGG + Intronic
959994908 3:112669882-112669904 CTCTTTTTCCATATCTACGAAGG + Intergenic
961089422 3:124097128-124097150 TTCTTTTTGAATATGGATGTGGG - Intronic
961126766 3:124425745-124425767 TTCTATTTTAATATCGGCGAAGG - Intronic
963097118 3:141555487-141555509 GTATTTTTCAACATAGATGAAGG + Intronic
964157675 3:153605261-153605283 TTGTTTTTCAATTCAGAGGAAGG + Intergenic
967516450 3:190374701-190374723 TTCTTTTTGAAAATAAATGATGG - Intronic
969048785 4:4357785-4357807 TGCTTTTTAAATTTAGACTAAGG + Intronic
969836907 4:9849829-9849851 TTCTGTTTCAATAGAGACGGAGG + Intronic
971329006 4:25666912-25666934 TTCTTTTTAAATAGAGACTTGGG + Intronic
973701625 4:53543031-53543053 TTGTTTTTAAATAGAGATGAGGG + Intronic
974217989 4:58925634-58925656 TTCTTTTTCTATATACACAGAGG - Intergenic
975113538 4:70653092-70653114 ATGTATTTCAATATAGACCATGG + Intronic
976355724 4:84115266-84115288 TTCTTTTTCAATACAAAGAAAGG + Intergenic
977433970 4:96969310-96969332 TTCCTTTTCATTAGAGATGAAGG - Intergenic
978578453 4:110209410-110209432 TTCTTTTTAAATATAGAAAGTGG + Intergenic
979213848 4:118139205-118139227 TTCATTTTCAGTACAGAGGAAGG - Intronic
979905796 4:126289987-126290009 TTCTTTCAGAATATAGAGGAGGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
982582229 4:157193669-157193691 TTATTATTCAATATAGGCAATGG - Intergenic
984749849 4:183261597-183261619 TTATTTTTCCATATAAACAAAGG + Intronic
987748322 5:22006189-22006211 TTTTTTTTTAATATAGATGGGGG + Intronic
988575407 5:32418474-32418496 TTCTTTTTCAAGAAAGATCAAGG + Intronic
988809999 5:34775556-34775578 TTCATTTTAAATAGAGATGAGGG - Intronic
989715549 5:44458298-44458320 TTATTTTACAATATAGAAGGTGG - Intergenic
990445598 5:55890973-55890995 TTCTATTTCAATATAGAAAAGGG - Intronic
990522426 5:56593012-56593034 TTCCTTTTCATCTTAGACGAAGG - Intronic
990618682 5:57536049-57536071 TTATTTTTAAATATAGAATAGGG + Intergenic
990764110 5:59163116-59163138 TTTTTTTTCAGTAGAGACGGGGG + Intronic
991768497 5:70015977-70015999 TTTTTTTTAAATATAGATGGGGG + Intergenic
991847735 5:70891059-70891081 TTTTTTTTAAATATAGATGGGGG + Intergenic
993092654 5:83445488-83445510 TTTTTTTTCTAGATAGACAAAGG + Intergenic
995020365 5:107360473-107360495 TGCTTTTTAAATATAGACAGCGG + Intergenic
995424722 5:112007695-112007717 TTGTTTTTTAATAAAGAGGAAGG + Intergenic
995443764 5:112220462-112220484 TTCTTTTGCAAAATGGAAGAAGG + Intronic
996272488 5:121623708-121623730 TTCTTTTTCTAAATAAAGGAAGG - Intergenic
996903368 5:128569974-128569996 TTCTTTTTCAATATATAATGAGG - Intronic
997049407 5:130362122-130362144 TCCATTTTCTATATAGACGCAGG + Intergenic
1000588933 5:163134907-163134929 ATCTTTTTTAATAGAGATGACGG - Intergenic
1000613199 5:163398074-163398096 TTCTGTTTAAAGATAGACTACGG - Intergenic
1001370813 5:171199059-171199081 TTTTTTTTAAATAGAGAAGAGGG - Intronic
1001651967 5:173322284-173322306 TTTTTTTTAAATATTGACAATGG - Intronic
1003528609 6:6919061-6919083 ATCTTTTTCAATTTAGACGTAGG - Intergenic
1003717194 6:8660167-8660189 TTCCTTTTCTATATAGAGGTGGG - Intergenic
1006687790 6:35851820-35851842 TCCTTTTTCAATTAAGAGGAAGG + Intronic
1007669535 6:43539950-43539972 TTATTTTTAAAAATAGAAGACGG + Intronic
1008217651 6:48814664-48814686 TACATTTTCAATATAGAATATGG + Intergenic
1009583864 6:65570904-65570926 TTCTTTTAGAATATAAACAAAGG - Intronic
1010312526 6:74404407-74404429 TTCTGTTTCATTATAGAGGCTGG + Intergenic
1011084800 6:83527767-83527789 ATCTTTTTCAAAATAAACAATGG - Intergenic
1011847721 6:91587308-91587330 TTTTCTTTCACTATAGATGATGG - Intergenic
1013874930 6:114813462-114813484 TTGTTTATAAATATAGACAAAGG - Intergenic
1014400575 6:120984863-120984885 TTAATTTTTATTATAGACGATGG + Intergenic
1014950268 6:127546235-127546257 TTCTTTTTCAATATCAAAAAAGG - Intronic
1015435339 6:133179926-133179948 TTCTTTTTTAAAATAGCTGAAGG + Intergenic
1015570669 6:134618160-134618182 GTCATTTTCAAAATAGACAAGGG + Intergenic
1016901914 6:149111468-149111490 TTCTTTTTCTGTAGAGACAAGGG + Intergenic
1016965223 6:149712521-149712543 TTCTTTTTGAATAGAGATGAGGG + Intronic
1017163523 6:151388540-151388562 TTCTTTTTTAATAGAGATGTGGG + Intronic
1017395412 6:153993179-153993201 TTTTTTTTCAAGATGGACTAGGG + Intergenic
1017785116 6:157750177-157750199 TTCTTTTTCAAGATAGATTGGGG - Intronic
1019053948 6:169206468-169206490 TACTTTTTCTATTTAGAAGAAGG + Intergenic
1020408237 7:7861415-7861437 TTATATTTCAAAATAGAAGATGG - Intronic
1020819836 7:12953438-12953460 TTCTTTTTCAACAAATAAGAAGG - Intergenic
1022269301 7:28790567-28790589 ATCTTTTTCAAAGTAGAGGAGGG - Intronic
1022604004 7:31790547-31790569 TTCTTTTGCAATGGAGATGACGG + Intronic
1023382167 7:39619885-39619907 TTTTTTTTTAATAGAGATGAGGG + Intergenic
1025168802 7:56737250-56737272 TTGTTTTTTAATATAAAGGAGGG - Intergenic
1025531340 7:61888824-61888846 TTCTTTTTCACCATAGACCTTGG + Intergenic
1025703589 7:63842662-63842684 TTGTTTTTTAATATAAAGGAGGG + Intergenic
1027585599 7:80054730-80054752 TTCTTGGTCAGTATAGACAAAGG + Intergenic
1028151720 7:87381271-87381293 TTGTTCTTCAAAATAGATGATGG + Intronic
1028282945 7:88955084-88955106 TTTTTTTTAAATAGAGACAAGGG - Intronic
1028427945 7:90711894-90711916 TTTTTTTTCAATTGAGCCGAGGG + Intronic
1029572635 7:101380466-101380488 TTATATTTTAATAGAGACGAGGG + Intronic
1029718738 7:102349002-102349024 TACATTTTTAATAGAGACGAGGG - Intergenic
1029753877 7:102560253-102560275 TACATTTTTAATAGAGACGAGGG + Intronic
1029771827 7:102659343-102659365 TACATTTTTAATAGAGACGAGGG + Intronic
1030421879 7:109317336-109317358 TTCTTTTCCAATTTAGATGCCGG - Intergenic
1030704861 7:112681762-112681784 TTTTTTTTTAATAGAGACGGGGG + Intergenic
1032054927 7:128676594-128676616 TTCTTTGTCAATATAGATAGAGG + Intronic
1033114235 7:138611202-138611224 TTTATTTTTAATAGAGACGAGGG - Intronic
1038111456 8:24504192-24504214 TTCTTTTTTTATATAGACAAAGG - Intronic
1038302395 8:26364952-26364974 TCTTTTTTCAGTATACACGAGGG - Intronic
1039336222 8:36592803-36592825 TTCTTTTTTAATTTTGAGGAAGG + Intergenic
1041288650 8:56286313-56286335 ATCATTTTCAATACAGAAGAAGG + Intergenic
1041707538 8:60862404-60862426 TTCTTTTCCCCTATAGAAGAAGG - Intronic
1042345543 8:67723337-67723359 TTTTATTTAAATAGAGACGAGGG + Intronic
1044834147 8:96279442-96279464 TTTTTTTTAAATTTAGAAGATGG - Intronic
1044919335 8:97151368-97151390 TTATTTTACAGTATAGAAGAAGG + Intergenic
1045028673 8:98114895-98114917 TTTTTTTTCAATCTACACCAGGG + Intronic
1045408179 8:101888588-101888610 TTTTTTTTTAATAGAGATGAGGG + Intronic
1046270592 8:111891322-111891344 TTTTTTTTTAATAGAGATGAAGG + Intergenic
1047479538 8:125268054-125268076 TTTTTTTTAAATAGAGATGAGGG - Intronic
1050683828 9:8145106-8145128 GTCTGTTTCCAAATAGACGAGGG + Intergenic
1050977634 9:11961888-11961910 TTATTTTTCAATTTAGAATAAGG - Intergenic
1052288158 9:26810841-26810863 TTCTATTTCATTGTAGATGATGG - Intergenic
1055267377 9:74511590-74511612 TTCTTTTGCTATATAGATGAGGG - Intronic
1056036919 9:82616510-82616532 TTCTTCTTCAATACAGACGTGGG + Intergenic
1056181049 9:84082799-84082821 TCCTATTCCAATATAGAAGAAGG - Intergenic
1056287056 9:85099468-85099490 TACTTTTTCAATAGAAACAATGG - Intergenic
1057072701 9:92114098-92114120 TTTTTTTTTAATAGAGACGGGGG - Intronic
1059086545 9:111309248-111309270 TTCTTTTTCTTTATGGACCATGG - Intergenic
1060274986 9:122175684-122175706 TTCTTTCTCATTATAGAGCAAGG - Intronic
1060644445 9:125265893-125265915 TTCTTTTTTAATAGAGACAGGGG - Intronic
1061585191 9:131562417-131562439 TTTTTTTTTAATACAGACAAGGG + Intergenic
1185906966 X:3943583-3943605 TTCTTTTTTGATTTAGACAAAGG - Intergenic
1185930190 X:4194292-4194314 TTTTTTTTCAGTAGAGACGGGGG + Intergenic
1186717714 X:12270250-12270272 TTTTTTTTCAAAAAAGACAATGG - Intronic
1186752931 X:12640460-12640482 TTCTTTTTCAATCTAGAGGTGGG - Intronic
1188185306 X:27107300-27107322 TGCTTTTGAAATAAAGACGATGG - Intergenic
1189113373 X:38317459-38317481 TTATTTTTCTTTATAGAGGATGG - Exonic
1190630388 X:52380487-52380509 TTCTTTCACAACATAGACCATGG - Intergenic
1190690847 X:52911819-52911841 TTCTTTTAGACTATAGAGGAGGG + Intergenic
1190695136 X:52943973-52943995 TTCTTTTAGACTATAGAGGAGGG - Intronic
1190886369 X:54534051-54534073 TTTTTTTTCAATAGAGATGAGGG + Intronic
1191826405 X:65370072-65370094 TTCTTTTTCAATATAGACGAGGG - Intronic
1196169328 X:112570262-112570284 TTCTTTTTTATTTTAGAGGATGG + Intergenic
1196519631 X:116658243-116658265 TTCTTTTTCATTATAAAGGCAGG - Intergenic
1196712063 X:118773095-118773117 CTCTTTTTCAAAATAGAGGAGGG - Intronic
1196947260 X:120840149-120840171 TCTTTTTTCAATACAGATGAAGG - Intergenic