ID: 1191837223

View in Genome Browser
Species Human (GRCh38)
Location X:65477215-65477237
Sequence TGACTGGTCTAGGGGATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191837213_1191837223 30 Left 1191837213 X:65477162-65477184 CCTGATGATTAGGGGTAATGGCA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1191837223 X:65477215-65477237 TGACTGGTCTAGGGGATCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 110
1191837217_1191837223 4 Left 1191837217 X:65477188-65477210 CCTAGCAAGGGCATGGAAGTCTC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1191837223 X:65477215-65477237 TGACTGGTCTAGGGGATCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191837223 Original CRISPR TGACTGGTCTAGGGGATCCA AGG Intronic
901750323 1:11402930-11402952 TGACTGGTCTAGGGATCCCATGG - Intergenic
905941852 1:41869412-41869434 TGACTGGTCTGGGGCCTCCATGG - Intronic
907405967 1:54253719-54253741 TGTCTGGACTGGGGGATCCCAGG + Intronic
909440396 1:75689961-75689983 TGCCTGGTCTAAGGGTCCCAAGG - Intergenic
913529198 1:119721444-119721466 TGCCTGGTCTAGGGCCTGCATGG + Intronic
920069153 1:203290025-203290047 TGACTGGTCTGGGGAAGACATGG + Intergenic
922808335 1:228401946-228401968 TGACTGGTCCTGGGGCGCCAAGG + Intronic
922898403 1:229118096-229118118 TGACTTGTCAAGGAGACCCAGGG + Intergenic
923468971 1:234273355-234273377 TGAGTGGTACAGGGGATGCAGGG + Intronic
923753620 1:236770331-236770353 TGATTGAGCTAGGGGACCCAGGG - Intergenic
924052481 1:240092531-240092553 TGACCGGTCCAGGGGGTCCTGGG + Exonic
924492241 1:244549778-244549800 TTACTGGGCTAGGGGATGCCCGG + Intronic
1063544905 10:6971335-6971357 TGTCTTGTCTAAAGGATCCAAGG - Intergenic
1063754834 10:8995541-8995563 GGACTGGTCTCGGGGATCTCCGG + Intergenic
1068083595 10:52347759-52347781 TGATTGGTCTATGGCAGCCATGG - Intergenic
1069907254 10:71739127-71739149 TGCATGGTCTAGGGGGTCGAGGG + Intronic
1070288263 10:75099200-75099222 TCACTGGTCCAGGGGATCAGGGG - Intronic
1070999423 10:80816094-80816116 TGGCTGGTCTAGAGGGTTCAAGG - Intergenic
1073959132 10:108905814-108905836 TCACTGGGCTACGGGATACAAGG - Intergenic
1079096930 11:17517089-17517111 AGAGTGGTCTAGGGGGTCCTGGG + Intronic
1085211382 11:74782530-74782552 TGACTGGTGTAGGGGTTGCGGGG - Intronic
1087935781 11:104033314-104033336 TGGCTGGACTATGGAATCCAAGG + Intronic
1091297696 11:134485516-134485538 TGTGTGGCCTTGGGGATCCAGGG + Intergenic
1094639574 12:32261021-32261043 TGACTGGGCTAGGCAATCAAGGG + Intronic
1097183326 12:57183430-57183452 TGACTTGTCATTGGGATCCAGGG - Exonic
1098855241 12:75645315-75645337 TGACTGGTCCAGGTGATTTATGG - Intergenic
1099841143 12:87968767-87968789 TGACTGTTCTGGTTGATCCAAGG + Intergenic
1100053547 12:90481083-90481105 TGACTCATCTAGAGGGTCCATGG + Intergenic
1101417667 12:104522552-104522574 TGAGTGGTCTGGGGGAACCCTGG - Intronic
1101612233 12:106302688-106302710 CGACGGGGCAAGGGGATCCAGGG - Intronic
1103992082 12:124806094-124806116 TGGATGGTCTAGGGGATGGATGG + Intronic
1112119637 13:96395822-96395844 GGAGTGGTATAGGGGATACAAGG + Intronic
1112656794 13:101460261-101460283 TTACTGGTGAAGGGGATTCAAGG - Intronic
1124175595 15:27421419-27421441 TGAGTGTTCTAAGGCATCCATGG + Intronic
1124175634 15:27421701-27421723 TGAGTGTTCTAAGGCATCCATGG + Intronic
1125487347 15:40121349-40121371 TGATTGGTCTAGGTGAAGCATGG - Intergenic
1127976222 15:63999172-63999194 TTACTGGCCTCTGGGATCCATGG - Intronic
1128074342 15:64816854-64816876 GGACTGGACGAGGAGATCCAGGG - Intronic
1129750104 15:78056751-78056773 TGACTTGTCTAGGTCATACAGGG + Intronic
1130330466 15:82918339-82918361 TGCCTGCTCTAGAGGATCCCTGG - Intronic
1130487189 15:84404609-84404631 AGGCTGGTCTCGGTGATCCACGG + Intergenic
1130680219 15:85990079-85990101 AGACTGGTCTAGGGAATTCGAGG + Intergenic
1141244620 16:82294330-82294352 TGACTGGTCCTGGGCACCCAAGG + Intergenic
1143707539 17:8709363-8709385 TGAATGGACTAGGGGCTCAAAGG + Intergenic
1145728614 17:27155887-27155909 TGCCTTCTCTGGGGGATCCACGG - Intergenic
1147607819 17:41784402-41784424 TGACTGGACTGGGGGATGCGGGG - Intronic
1149584452 17:57776189-57776211 TCACGGGTCAAGGCGATCCACGG - Intergenic
1152018356 17:77766834-77766856 AGACTGGCCTGGGGGATCCTGGG - Intergenic
1153962830 18:10153961-10153983 TAACTGGTCTAGAGGGTCCAGGG - Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1159849365 18:73508767-73508789 TGACTGGACTACGGGATACTAGG - Intergenic
1163271609 19:16257960-16257982 GGACTGGGCTAGGGGACACAAGG + Intergenic
1164902709 19:31941620-31941642 TGACTGGTCTGGGCTATTCAAGG - Intergenic
1167508554 19:49883837-49883859 TCACTGGTCTTGGGGAGGCAGGG - Intronic
929393236 2:41495282-41495304 TGACAGGGCTCGGGGAACCAAGG + Intergenic
930245879 2:48982916-48982938 TGACTGGTCCAGAGGCTCCGTGG + Exonic
932714789 2:74093283-74093305 TGCCTTGTCTAGGAGATACAAGG - Intronic
933595659 2:84280662-84280684 TGACTGGGCTAAGGGATGCCCGG - Intergenic
935916323 2:107954898-107954920 TGACTATTCTAGGGGATAGAAGG - Intergenic
941755042 2:169176014-169176036 TGCCTATGCTAGGGGATCCAGGG - Intronic
942939120 2:181596539-181596561 TGACTGGTTTATGGGATGCTTGG - Intronic
948863776 2:240765360-240765382 GGGCTGGTCTGGGGGATACAGGG - Intronic
1174516232 20:51094426-51094448 TGACTTGGCTAGGGGACCCTGGG + Intergenic
1174695546 20:52552977-52552999 TCACTGGGCTATGGGATCCCTGG + Intergenic
1179615145 21:42578912-42578934 TCACTGGTCCAGGGGAGGCAGGG - Intronic
1182285644 22:29245399-29245421 GGACTGGTCTAGGGTGGCCAGGG - Intronic
1182428912 22:30289051-30289073 GGGCTGGACTAGGGGGTCCAAGG - Intronic
1183352936 22:37343905-37343927 GGCCTGGCCTAAGGGATCCAGGG - Intergenic
954070943 3:48142480-48142502 TGACTGGTCTGGGAGCTCCGAGG - Intergenic
958709798 3:97704181-97704203 TGACTGGCCTAAGGGATGCCTGG + Intronic
963324966 3:143852294-143852316 AGTCTGGTCTGTGGGATCCAGGG + Intergenic
964791814 3:160460244-160460266 TGACTGGAGTAGGGGACTCATGG - Intronic
973106851 4:46349672-46349694 AGACTGATCCAGGAGATCCAGGG - Intronic
977366243 4:96072005-96072027 TTACTGGTCTAGGTGAGCCACGG + Intergenic
979502400 4:121455437-121455459 TGAATGGCCAAGGGGAGCCAGGG + Intergenic
982665033 4:158251281-158251303 TGCCTGGTCTAAGGGTCCCAAGG - Intronic
984329589 4:178297849-178297871 TAACTGGTATAGGGCATCCTAGG - Intergenic
986118345 5:4803628-4803650 TGACAGGTGAAGGGGCTCCAAGG - Intergenic
991639245 5:68737050-68737072 CGAGTGGTCCAGGGGAGCCAGGG - Intergenic
994933651 5:106222377-106222399 TGGCTCAGCTAGGGGATCCAGGG + Intergenic
995113916 5:108457905-108457927 AGACTAGTCTAGGGAATTCAAGG + Intergenic
998502160 5:142642793-142642815 TCACTGGTCTACAGGATCCCAGG - Intronic
999198203 5:149797189-149797211 TGGCTGGTCTAGGTTATCCCAGG - Intronic
1000942821 5:167383366-167383388 TCATTGGTTTAAGGGATCCAAGG - Intronic
1002183026 5:177441282-177441304 TGCCTGGCCTCGGGGAGCCACGG + Intronic
1002643986 5:180644208-180644230 TGGCTGGTTTTGAGGATCCAAGG + Intronic
1002818308 6:698710-698732 TGCCTGGTATGGCGGATCCACGG - Intergenic
1004581783 6:16961392-16961414 TGAGTGGTCTCGGTGTTCCAGGG + Intergenic
1006405362 6:33841894-33841916 TCACTGGACTACGGGCTCCAAGG - Intergenic
1023152750 7:37217291-37217313 TGACTGGTATGGAGGATTCAAGG + Intronic
1029162469 7:98562519-98562541 TGATTGTTCCAGGGGATCCAGGG - Intergenic
1033637718 7:143227345-143227367 TGACTGAACTACTGGATCCATGG - Intergenic
1033710606 7:143939140-143939162 GGACTGGTCTGGGGCCTCCATGG + Intergenic
1034245531 7:149641517-149641539 GGAATGGTCACGGGGATCCATGG - Intergenic
1041094769 8:54339070-54339092 CGACTGGGCTAGGTGAGCCACGG - Intergenic
1041184562 8:55285726-55285748 TATCTGGTCTTGGGGATGCATGG + Intronic
1041808936 8:61886756-61886778 GGCCTGCTCTAGGAGATCCAGGG - Intergenic
1047234233 8:123025355-123025377 TCACTGGTCTTTGGGATACAGGG - Intronic
1047788844 8:128181692-128181714 TGACTGGTCTAGGGTGACCTGGG - Intergenic
1048878682 8:138856183-138856205 TGACTGCTCTAGGGGAGCCTCGG - Intronic
1055319826 9:75072214-75072236 TGACATGGCTATGGGATCCATGG - Intronic
1060833242 9:126733260-126733282 TGACTTGTCTGGTGGTTCCACGG + Intergenic
1186444028 X:9610634-9610656 TGACTGCTTTAGGGCATCCCAGG + Intronic
1188026679 X:25217362-25217384 TGACTGGGCTAAGGGATGCCTGG + Intergenic
1188191444 X:27175692-27175714 AGAGTGGTCTTGGGGATCCCTGG + Intergenic
1189006295 X:36998952-36998974 TGACAGGACTTGGGGATGCAAGG + Intergenic
1189042299 X:37554853-37554875 TGACAGGACTTGGGGATGCAAGG - Intronic
1191104552 X:56764385-56764407 TGACTGGTCTTGGGGCTGCCTGG + Intergenic
1191105215 X:56768261-56768283 TGACTGGTCTTCGGGATGCCTGG + Intergenic
1191106208 X:56773663-56773685 TGACTGGTCTTCGGGATGCCTGG + Intergenic
1191107201 X:56779065-56779087 TGACTGGTCTTCGGGATGCCTGG + Intergenic
1191111090 X:56803505-56803527 TGACTGGTCTTGGGGCTGCCTGG + Intergenic
1191837223 X:65477215-65477237 TGACTGGTCTAGGGGATCCAAGG + Intronic
1195609216 X:106845939-106845961 TGACTTGTCTAGTGGTTCCCTGG - Intronic
1197655031 X:129107609-129107631 TGACTGCCCTAGGCTATCCAGGG + Intergenic
1199699137 X:150363559-150363581 TGACTGTTCTGGGGGTTCCGGGG + Intronic
1200936657 Y:8744271-8744293 TGTCTGCTCTGTGGGATCCAAGG - Intergenic