ID: 1191841548

View in Genome Browser
Species Human (GRCh38)
Location X:65516849-65516871
Sequence CCTTGTATGGACAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191841548 Original CRISPR CCTTGTATGGACAGGGTGGA AGG (reversed) Intronic
901402879 1:9026300-9026322 CCCTGGATGGAATGGGTGGAGGG + Exonic
902257851 1:15202198-15202220 CCTCGTGTGGCCAGGTTGGAGGG - Intronic
902460229 1:16569381-16569403 CCTTCTAAATACAGGGTGGAGGG + Intronic
905544624 1:38787670-38787692 CCTTGGAAGGCCAGGGCGGATGG + Intergenic
906490039 1:46261081-46261103 TCATTTATGGCCAGGGTGGAGGG + Intronic
906525127 1:46489418-46489440 CCTTGAAGGGACAGTGGGGACGG + Intergenic
907285373 1:53376427-53376449 CCTTCCATGGACAGGGGTGAAGG + Intergenic
912178598 1:107190724-107190746 CCTTGTAGGGACATGGATGAAGG - Intronic
912428791 1:109617544-109617566 GCTGGTATGGAGTGGGTGGAGGG + Exonic
913605188 1:120459200-120459222 CCTTCTAAATACAGGGTGGAGGG - Intergenic
913642054 1:120821937-120821959 CCTTCTAAATACAGGGTGGAGGG - Intronic
914083350 1:144430008-144430030 CCTTCTAAATACAGGGTGGAGGG + Intronic
914276426 1:146128427-146128449 CCTTCTAAATACAGGGTGGAGGG + Intronic
914366391 1:146982761-146982783 CCTTCTAAATACAGGGTGGAGGG - Intronic
914486056 1:148110686-148110708 CCTTCTAAATACAGGGTGGAGGG + Intronic
914537470 1:148579382-148579404 CCTTCTAAATACAGGGTGGAGGG + Intronic
914586388 1:149065834-149065856 CCTTCTAAATACAGGGTGGAGGG + Intronic
914628456 1:149485963-149485985 CCTTCTAAATACAGGGTGGAGGG - Intergenic
916091394 1:161310112-161310134 CATTGTATAGTCTGGGTGGAGGG + Intergenic
917904961 1:179579549-179579571 CACTTTATGGACAAGGTGGAAGG + Intergenic
918994858 1:191744175-191744197 CCTTGTCTTCACATGGTGGAAGG + Intergenic
921620563 1:217321960-217321982 CTTGGTATAGTCAGGGTGGAAGG - Intergenic
924274827 1:242375122-242375144 CTTGGTAGGGACAGGCTGGATGG - Intronic
1063062864 10:2576774-2576796 ACCTGGATGGACAGGGTAGATGG + Intergenic
1064461689 10:15540794-15540816 CCTGGTATAGACAGGATGAAGGG + Intronic
1068484460 10:57639600-57639622 CATTGTATAAACATGGTGGAAGG - Intergenic
1070430453 10:76332643-76332665 CCTAGAATGTACAGGGTGGAAGG + Intronic
1072649243 10:97281137-97281159 CCTTGTGAGGACAAGGTGGCAGG + Intronic
1075168234 10:120088645-120088667 TCTTCTATGGACAGGGTCCATGG - Intergenic
1076318391 10:129559924-129559946 CCTTGGATGGTCAGCATGGAAGG + Intronic
1076371026 10:129953747-129953769 CCTTGCTTGGGCTGGGTGGATGG - Intronic
1078955595 11:16190961-16190983 ACTTGTATTCACAGGTTGGATGG - Intronic
1080569555 11:33543442-33543464 GCTTGTATGGAGAGTATGGAAGG - Exonic
1080577004 11:33609265-33609287 GCTGGGACGGACAGGGTGGAAGG - Intronic
1080605029 11:33858304-33858326 CATTGTATGGAGTGAGTGGAAGG - Intergenic
1080656410 11:34262062-34262084 CCTTGTGTGGAAAAGGTGGGAGG + Intronic
1081553380 11:44134690-44134712 GTTTGTATGGATAGGGAGGAAGG + Intronic
1082083270 11:48028414-48028436 CCTTGTGTGGGCTGGGTGCAGGG + Intronic
1085751238 11:79162902-79162924 CCTTGTATGAACAGGGACTATGG - Intronic
1087869475 11:103274249-103274271 CTTTGCATGGTCAAGGTGGAAGG + Intronic
1088618707 11:111660264-111660286 CCTTGTATCTGGAGGGTGGAAGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091106277 11:132922423-132922445 CTCTGTTTGCACAGGGTGGAAGG - Intronic
1092539680 12:9413201-9413223 TCATGTATGGACAGGGTGCTCGG + Intergenic
1092778465 12:11964224-11964246 CTTTCTATGGACATGGTGTAAGG - Intergenic
1096521280 12:52186134-52186156 GCTCGGCTGGACAGGGTGGAGGG - Intronic
1097669172 12:62515570-62515592 CTTTGTAAGGCCAAGGTGGATGG + Intronic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1103080982 12:118023741-118023763 CCTTCTATGGGCAGGGAGGGCGG - Intronic
1103289662 12:119834661-119834683 CCTTTTATAGTCAGTGTGGAAGG + Intronic
1106559318 13:30834681-30834703 CCTTCTATAAATAGGGTGGACGG + Intergenic
1109313983 13:60727963-60727985 CTTTGTAGGCACAGGATGGAGGG + Intergenic
1109692813 13:65915356-65915378 CCATGTGTGCACAGTGTGGAAGG - Intergenic
1111965358 13:94856495-94856517 CCTGCTATGGACAAGGTGGTTGG - Intergenic
1112374092 13:98822701-98822723 CCTTGAAAGGCCTGGGTGGATGG - Intronic
1114222577 14:20710073-20710095 CCTTGGATGAAAAGGGTGAAGGG + Intergenic
1114652209 14:24292415-24292437 CCTGGGAAGGACAGGGTGGGTGG - Intronic
1116400634 14:44502477-44502499 GCTTGTATGTATGGGGTGGAGGG + Intergenic
1117921762 14:60732003-60732025 CCTTGGATGAACACGTTGGAAGG + Intergenic
1120194047 14:81463876-81463898 CCTTATATGGGAAAGGTGGAGGG - Intergenic
1123142652 14:106095724-106095746 CCCTTTATGGACAGGGAGCATGG + Intergenic
1123144109 14:106111316-106111338 CCATGTAGGGTCAGTGTGGATGG + Intergenic
1126808110 15:52373629-52373651 CTGTGACTGGACAGGGTGGAAGG - Intronic
1127433443 15:58933832-58933854 CCTTGTGTGGACTGGGAGGTCGG + Intronic
1128508865 15:68301452-68301474 CCATCTATGGCCAGTGTGGACGG - Intronic
1129312904 15:74725039-74725061 CCTTGGGTGGACAGGGTGGATGG - Intronic
1130780317 15:87030865-87030887 ACTTGTATGGACTGGGTGAGAGG - Intergenic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1131761562 15:95628331-95628353 CATTGTATGGCCAGGATGCAGGG + Intergenic
1132528232 16:428300-428322 TCCTGTATGGTCAGCGTGGATGG + Intronic
1135394496 16:22120879-22120901 ACTTGCATTGACTGGGTGGAGGG + Intronic
1135429768 16:22373816-22373838 CCTTTCATGGCCAGCGTGGAGGG - Intronic
1139536753 16:67580446-67580468 CCTTGGATGGCCTGGGAGGAGGG - Intronic
1141620320 16:85233905-85233927 CCATGTGTGGACAGGGGGCAGGG - Intergenic
1141815664 16:86407957-86407979 CCTTGTATGAAAAGTGTGGCAGG + Intergenic
1142292001 16:89197451-89197473 CCCTGAGTGGCCAGGGTGGAAGG - Intronic
1145292572 17:21560186-21560208 CCTTGTCTGGCCAGGGTACAAGG - Intronic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1145768465 17:27475636-27475658 CCCTGTAAGGATGGGGTGGACGG - Intronic
1147714150 17:42492770-42492792 CTTTGTGGGGACAAGGTGGAAGG + Intronic
1148674880 17:49439356-49439378 CCTTGTAGGGACTGAATGGAGGG - Intronic
1148691190 17:49528009-49528031 ACATGAATGGGCAGGGTGGATGG + Intergenic
1149342696 17:55702859-55702881 CCTGGCTTGGACTGGGTGGATGG - Intergenic
1149888210 17:60361979-60362001 CTTTGTATGGACATAGTAGAAGG - Intronic
1150892791 17:69173457-69173479 CTTTCTGTGGACAGGGTGAAGGG - Intronic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1152420916 17:80192704-80192726 CCCTGTGGGGACAGGGTGGAAGG - Intronic
1152723640 17:81934831-81934853 CCTGGGAGGGCCAGGGTGGAGGG - Intronic
1153694772 18:7629235-7629257 CCTTCTGTGGACAGGTTAGATGG - Intronic
1153838651 18:8986889-8986911 CATTGTATGGCCAAGGTGAAGGG - Intergenic
1157640840 18:49212738-49212760 CTTTGGAAGGCCAGGGTGGATGG - Intronic
1166075237 19:40410360-40410382 CATTGTGTGGCCAGGGTGGGTGG - Intronic
1166266553 19:41688135-41688157 CTCTGTATGGACAGGCTGAAGGG + Exonic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
1167316048 19:48763328-48763350 CTTTGTAAGGCCAGGGTGGGCGG + Intergenic
1168405368 19:56107767-56107789 CCCTGGATGGGCAGCGTGGAGGG + Intronic
1202676661 1_KI270711v1_random:13109-13131 CCTTCTAAATACAGGGTGGAGGG + Intergenic
928879777 2:36084956-36084978 CCAAGCATGGACTGGGTGGAAGG - Intergenic
932862815 2:75312157-75312179 CCCTGTATGGCCAGTGTGAAAGG + Intergenic
942337202 2:174901293-174901315 CCTTGCATGGACATGCTGGTCGG + Intronic
945089628 2:206166686-206166708 CCTTGGAAGGCCAAGGTGGAAGG - Intergenic
945289035 2:208109841-208109863 CTTTGGAAGGCCAGGGTGGAAGG + Intergenic
946800424 2:223409740-223409762 CCTGGTATTTACAGGGTGGTGGG - Intergenic
947622481 2:231599552-231599574 CCTGGTATGGACAAGGTGAGGGG - Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948861784 2:240756113-240756135 CCTTGGGTGGAGATGGTGGAAGG - Intronic
948922937 2:241074291-241074313 CCTTGTATGGTGAGGGCGGGGGG - Intronic
1168787967 20:556298-556320 ACGTATATGGAGAGGGTGGAGGG + Intergenic
1172612552 20:36262629-36262651 CCTTGTCTGGACAACGAGGAAGG - Intronic
1174435758 20:50505631-50505653 CCTTGTAGGAACAGGGCAGAGGG + Intergenic
1176164110 20:63663933-63663955 CCTTGGAGGGACAGGGTGGGCGG + Intronic
1177095867 21:16831881-16831903 CCTTGTATAGTCAGGATGAACGG + Intergenic
1178399045 21:32267557-32267579 CCTAGTATGAACAGGGTATAAGG + Intergenic
1181869215 22:25884715-25884737 CCTTGTATGTCCAGTTTGGAGGG + Intronic
1182747086 22:32614414-32614436 CTCTGTATGGACACAGTGGAGGG + Intronic
1183881011 22:40829727-40829749 TCTTGCATGGACAGGTTGCATGG - Intronic
1184490322 22:44804544-44804566 CCTTGTGAGGACAGGGAGCACGG + Intronic
1184606341 22:45576811-45576833 CCCTGTGTGGGGAGGGTGGAGGG - Intronic
949251505 3:1990008-1990030 CCTTGTATGAACATGGTATAAGG + Intergenic
950689221 3:14642354-14642376 TCTTGTCTGTACAGGGTTGAAGG - Intergenic
950882533 3:16334872-16334894 CCTTATAAGGACAGGCAGGAAGG + Intronic
951546221 3:23828940-23828962 CTTTCAGTGGACAGGGTGGATGG + Intronic
953111313 3:39942254-39942276 CATTGTATGTACGGCGTGGAAGG + Intronic
954685040 3:52365695-52365717 CCTTGTGTGGCCAGGGTGACTGG - Intronic
955389679 3:58512137-58512159 CCAGGTTTGGGCAGGGTGGACGG - Intronic
956631841 3:71324459-71324481 CCTTGTAGGGACACGGATGAAGG + Intronic
960720106 3:120617266-120617288 GCTTGTCTGGATAAGGTGGAGGG + Intergenic
961642101 3:128371230-128371252 CCTTGGATGGATGGGGAGGAGGG + Intronic
962035948 3:131651696-131651718 TGTTGTATGGACAGAGGGGATGG + Intronic
962636494 3:137337365-137337387 CCTGGGAGGGACAGTGTGGAAGG + Intergenic
964604296 3:158542653-158542675 CCTAGGATGGAAAGGTTGGAAGG + Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
969178479 4:5418884-5418906 CTTAGTTTGGACATGGTGGAGGG + Intronic
970219676 4:13797836-13797858 TCTTCTATGGACATGGGGGATGG + Intergenic
970538974 4:17058623-17058645 CTTAGAAGGGACAGGGTGGAGGG + Intergenic
971614573 4:28771383-28771405 CCTTGTCTTCACATGGTGGAAGG + Intergenic
973066064 4:45794766-45794788 CCTTGTATGATCAAGGTAGATGG - Intergenic
973766432 4:54167492-54167514 CCATGTCTGCACATGGTGGAAGG + Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
982446559 4:155497495-155497517 CCTTGTGTCCACATGGTGGAAGG + Intergenic
985111032 4:186546602-186546624 TGTTGTATGAACAGGGTGCAAGG - Intronic
985121189 4:186643698-186643720 TCTTGTATGGCCAGAGTGCAGGG - Intronic
985588916 5:754898-754920 CCTCGTGTTGAAAGGGTGGAGGG - Intronic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
991189840 5:63857319-63857341 ACTTGTATGAAAAGTGTGGAGGG - Intergenic
991926096 5:71706403-71706425 GCTTGTCAGGACAGGGTGAATGG - Intergenic
992549800 5:77849714-77849736 CCTTCTCTGGAGAGGGTGCAGGG + Intronic
992642568 5:78780624-78780646 CATTGTATTGAGACGGTGGAGGG + Exonic
996038801 5:118787710-118787732 TCTTGTGTTGACAGTGTGGAAGG + Intergenic
999661083 5:153863463-153863485 CCCTGTATCAACAGGGAGGAAGG - Intergenic
1003301892 6:4891699-4891721 CCTTTTATGAACAGGTTGAAAGG + Exonic
1006626203 6:35399718-35399740 CCCTGTATGAAGAGGGTGGTAGG - Intronic
1006974440 6:38085351-38085373 CCTTGTATGGATAGATTGGATGG - Intronic
1007278091 6:40690329-40690351 CCAAGTATGGGCTGGGTGGAAGG + Intergenic
1009312245 6:62169892-62169914 CTTTGTCTGGTGAGGGTGGATGG - Intronic
1016376805 6:143429900-143429922 CTTTGACGGGACAGGGTGGATGG - Intronic
1021478563 7:21090764-21090786 CTTTGTAGGGACATGGTTGAAGG + Intergenic
1023181360 7:37487000-37487022 CCTGGGATGGACATGGTGGGTGG - Intergenic
1024291106 7:47804926-47804948 CCTCCTGTGGACAGAGTGGAAGG + Intronic
1025943267 7:66088744-66088766 CCCTGTATGGTCAGGCTGGGTGG + Intronic
1028941824 7:96530188-96530210 GCTTGTCTGGACTGGGTGGGTGG + Intronic
1030219983 7:107088377-107088399 CCTGGGAAGTACAGGGTGGAGGG + Intronic
1035315887 7:157997482-157997504 CCTTGCAGGGCCAGTGTGGATGG - Intronic
1035812053 8:2500777-2500799 CTTTGTAGGCACAGGATGGAAGG - Intergenic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037628421 8:20629285-20629307 CCTTGTGTAGACAGGGTTCAGGG + Intergenic
1040088321 8:43368227-43368249 CTTTGGATGGACAAGGTGGGCGG - Intergenic
1041861671 8:62520946-62520968 GCTTGTATGGAAAGAGTGCATGG + Intronic
1042463710 8:69101919-69101941 GCTTGTTTTCACAGGGTGGAGGG - Intergenic
1045034293 8:98165397-98165419 ACTTGTATACACAGGGTGGTAGG + Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1047155679 8:122315289-122315311 CCTTGTAAGGGCTGGGTGAATGG - Intergenic
1047643315 8:126843970-126843992 CCTTGGTTGGACAGGGAGCAGGG - Intergenic
1048440454 8:134455717-134455739 CCTTGTAGCAACAGGGTGGCTGG - Intergenic
1050095371 9:2059414-2059436 CCTGGTATGGAGAGGGAGGCAGG - Intronic
1056287679 9:85107865-85107887 ACTCATATGGGCAGGGTGGAGGG + Intergenic
1057023674 9:91719742-91719764 ACTTGTAGGGGGAGGGTGGAGGG + Intronic
1057266723 9:93622257-93622279 CGGTGTATGGACAGGCTGGCTGG - Intronic
1060483829 9:124034464-124034486 CATTGTTGGGATAGGGTGGAGGG + Intergenic
1062166935 9:135112633-135112655 CCCTGTGCGGACTGGGTGGACGG - Intronic
1185749331 X:2598137-2598159 CCTTGAAAGGAAAGGATGGATGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1189213281 X:39302594-39302616 TTTTCCATGGACAGGGTGGAGGG - Intergenic
1189789916 X:44593388-44593410 CTTTGTTTGCACATGGTGGAAGG + Intergenic
1191841548 X:65516849-65516871 CCTTGTATGGACAGGGTGGAAGG - Intronic
1195037731 X:100985419-100985441 CCAAGTATGGGCAGGGTGGCAGG + Intronic
1200869568 Y:8082889-8082911 CCCTGTAAGGACAGGTTTGAAGG + Intergenic