ID: 1191841549

View in Genome Browser
Species Human (GRCh38)
Location X:65516849-65516871
Sequence CCTTCCACCCTGTCCATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191841545_1191841549 25 Left 1191841545 X:65516801-65516823 CCATACACACACACACAGAGAGA No data
Right 1191841549 X:65516849-65516871 CCTTCCACCCTGTCCATACAAGG No data
1191841544_1191841549 26 Left 1191841544 X:65516800-65516822 CCCATACACACACACACAGAGAG No data
Right 1191841549 X:65516849-65516871 CCTTCCACCCTGTCCATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191841549 Original CRISPR CCTTCCACCCTGTCCATACA AGG Intronic