ID: 1191841549 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:65516849-65516871 |
| Sequence | CCTTCCACCCTGTCCATACA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1191841545_1191841549 | 25 | Left | 1191841545 | X:65516801-65516823 | CCATACACACACACACAGAGAGA | No data | ||
| Right | 1191841549 | X:65516849-65516871 | CCTTCCACCCTGTCCATACAAGG | No data | ||||
| 1191841544_1191841549 | 26 | Left | 1191841544 | X:65516800-65516822 | CCCATACACACACACACAGAGAG | No data | ||
| Right | 1191841549 | X:65516849-65516871 | CCTTCCACCCTGTCCATACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1191841549 | Original CRISPR | CCTTCCACCCTGTCCATACA AGG | Intronic | ||