ID: 1191842378

View in Genome Browser
Species Human (GRCh38)
Location X:65522477-65522499
Sequence GAGCTCAGCTACCCGGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191842370_1191842378 24 Left 1191842370 X:65522430-65522452 CCTCTGCAGTGGCAGCAATCCGC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1191842378 X:65522477-65522499 GAGCTCAGCTACCCGGGCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 225
1191842374_1191842378 5 Left 1191842374 X:65522449-65522471 CCGCAGGGCTATGTGGTTTTCTC 0: 1
1: 0
2: 0
3: 22
4: 218
Right 1191842378 X:65522477-65522499 GAGCTCAGCTACCCGGGCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191842378 Original CRISPR GAGCTCAGCTACCCGGGCTG AGG Intronic