ID: 1191842539

View in Genome Browser
Species Human (GRCh38)
Location X:65523559-65523581
Sequence CATCCGAAGGAGTTGGGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191842532_1191842539 7 Left 1191842532 X:65523529-65523551 CCTCTTACCGGATGGAATTCAAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1191842539 X:65523559-65523581 CATCCGAAGGAGTTGGGGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 148
1191842527_1191842539 29 Left 1191842527 X:65523507-65523529 CCTGAGGCTTGAAGGGCCTCACC 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1191842539 X:65523559-65523581 CATCCGAAGGAGTTGGGGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 148
1191842530_1191842539 13 Left 1191842530 X:65523523-65523545 CCTCACCCTCTTACCGGATGGAA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1191842539 X:65523559-65523581 CATCCGAAGGAGTTGGGGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 148
1191842526_1191842539 30 Left 1191842526 X:65523506-65523528 CCCTGAGGCTTGAAGGGCCTCAC 0: 1
1: 0
2: 1
3: 18
4: 293
Right 1191842539 X:65523559-65523581 CATCCGAAGGAGTTGGGGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 148
1191842531_1191842539 8 Left 1191842531 X:65523528-65523550 CCCTCTTACCGGATGGAATTCAA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1191842539 X:65523559-65523581 CATCCGAAGGAGTTGGGGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 148
1191842533_1191842539 0 Left 1191842533 X:65523536-65523558 CCGGATGGAATTCAAGAGACTTA 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1191842539 X:65523559-65523581 CATCCGAAGGAGTTGGGGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191842539 Original CRISPR CATCCGAAGGAGTTGGGGGC TGG Exonic
900115284 1:1025543-1025565 AATGCGGAGGAGTTGGGGGCAGG - Intronic
900577975 1:3393815-3393837 CCCCCGAAGCAGTTGGAGGCAGG + Intronic
902081016 1:13820735-13820757 CAGCAGCAGGAGCTGGGGGCTGG - Intronic
905829887 1:41057098-41057120 CAACCCAAAGAGGTGGGGGCGGG + Intronic
906530010 1:46518327-46518349 CATGAGAAGGAGGTGGGGGCAGG + Intergenic
910993492 1:93079560-93079582 CTTCCGGAGGAGATGGGGGTTGG + Intronic
919109012 1:193193182-193193204 CAGCCTAAGAAGTTGGGGGCAGG - Intronic
919923701 1:202181424-202181446 CATCCTGAGGAGCTGGGTGCAGG + Intergenic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
923537931 1:234867340-234867362 CATCAGATGGGGTTGGAGGCTGG + Intergenic
1063050218 10:2439080-2439102 CATGGAAAGGAGTTGGGGGGTGG + Intergenic
1064541935 10:16414319-16414341 CATCAGAGGGAGTTGGGGTGGGG + Intergenic
1065804281 10:29380670-29380692 AACCAGCAGGAGTTGGGGGCGGG - Intergenic
1070306483 10:75242495-75242517 CATCCCAAGCAGTTAGAGGCTGG - Intergenic
1072612913 10:97031018-97031040 CCTCCGAAGGGCTTGGGGACAGG - Intronic
1073100530 10:101004040-101004062 CATCCGAAGGAGGTGGAGGCGGG - Exonic
1075869058 10:125755062-125755084 GATCCTGAGGAATTGGGGGCAGG - Intronic
1075898391 10:126018335-126018357 CAGCCCATGGGGTTGGGGGCAGG + Intronic
1076618904 10:131774618-131774640 CAACCCATGGTGTTGGGGGCAGG - Intergenic
1076624454 10:131812919-131812941 CATCCCGAGGAGGTGGGGGCTGG - Intergenic
1080410686 11:32022260-32022282 CAGTGGAAGGAGTTGGGAGCAGG - Intronic
1080865099 11:36187049-36187071 AATTAGCAGGAGTTGGGGGCAGG - Intronic
1081850904 11:46274651-46274673 CATCTGAAGGAGTTAGGGGATGG - Intergenic
1081928538 11:46851072-46851094 CAACCGCAGGGGGTGGGGGCGGG - Intergenic
1083644435 11:64164505-64164527 CAGCAGGAGGAGTTTGGGGCTGG - Intronic
1083691116 11:64409535-64409557 CACCCGGAGGTGGTGGGGGCGGG - Intergenic
1084195867 11:67523408-67523430 CATCGGGAGCAGCTGGGGGCTGG - Intronic
1085740530 11:79074710-79074732 CACCAGGAGGAGATGGGGGCAGG + Intronic
1086949375 11:92876051-92876073 CATCAGAAGCACCTGGGGGCAGG - Intronic
1087952276 11:104237463-104237485 CAGGAGATGGAGTTGGGGGCAGG + Intergenic
1088916993 11:114235027-114235049 TATCTGAAGGATTTGGGGGCTGG + Intronic
1090035053 11:123242044-123242066 CACCGGAAGGAGTGGGTGGCAGG + Intergenic
1091455807 12:606973-606995 CCTCCGGAAGAGTTGGGGCCGGG - Intronic
1092230343 12:6772608-6772630 CAGCCTGAGGAGGTGGGGGCGGG - Exonic
1092462329 12:8697815-8697837 CGGCCGGAGGAGCTGGGGGCCGG - Intronic
1097186984 12:57201379-57201401 CCTCCGAAGAAGTTGCTGGCAGG + Intronic
1102101190 12:110280645-110280667 CGTGCGAAGGAGCTGGCGGCAGG + Intergenic
1102614138 12:114138371-114138393 CTTCCGCAGCAGTTTGGGGCTGG + Intergenic
1103419890 12:120771917-120771939 CATATGAAGGAGCCGGGGGCAGG - Intronic
1104039442 12:125120147-125120169 GATGAGAAGGAGTTGGGGTCGGG - Intronic
1104469998 12:129022228-129022250 CATCCCAAGGACTTAGAGGCTGG + Intergenic
1106409125 13:29498892-29498914 CAGCCGTAGGAGTTAGGCGCAGG - Intronic
1108478563 13:50843995-50844017 CCTTCGAAGGAGGTGGGGGCGGG - Intergenic
1108481524 13:50877497-50877519 CAACCCAAGAAGTTGGTGGCTGG - Intergenic
1115336650 14:32249133-32249155 CCTCCGAAGGACTTGGGGTTTGG + Intergenic
1118925408 14:70187097-70187119 CACCCGAAGGGGGTGGGGGGAGG - Intronic
1118979004 14:70701157-70701179 CATCCCAAGGGCTTTGGGGCTGG - Intergenic
1120902696 14:89589712-89589734 CATGAGAATGAATTGGGGGCGGG + Intronic
1122162544 14:99794804-99794826 CCTCAGAAGGTGTTGAGGGCAGG + Intronic
1122207718 14:100156537-100156559 CAGATGAAGGAGTTGGGGCCTGG - Intronic
1122245291 14:100398552-100398574 CATTCGAAGAAGTTGGGTGAAGG - Intronic
1122762341 14:104038489-104038511 CAGCTGAAGGATTTGGAGGCTGG + Intronic
1122890338 14:104729294-104729316 CATCCCAAGGATTTAGGGACGGG + Intronic
1123663356 15:22586189-22586211 CAGCAGCAGGGGTTGGGGGCGGG - Intergenic
1124566264 15:30816853-30816875 CAGCAGCAGGGGTTGGGGGCGGG + Intergenic
1129496625 15:75988481-75988503 CATTAGAAGGAGTTGTAGGCTGG - Intronic
1130954202 15:88615365-88615387 CATTCTCAGGAGTTGGGGGAGGG + Intergenic
1131067746 15:89444717-89444739 CTTCAGATGGAGTGGGGGGCAGG - Intergenic
1131862646 15:96670569-96670591 CAGCAGAAGGAGTTGGGAGGAGG + Intergenic
1133691855 16:8223304-8223326 CATAAGAAGGGGTTGGGGGACGG - Intergenic
1135677710 16:24431210-24431232 CACCCAGAGGAGCTGGGGGCTGG - Intergenic
1138577974 16:57920662-57920684 TGTCAGAAGGAGATGGGGGCAGG - Intronic
1139681898 16:68571562-68571584 CACCTGAAGGATTTGGGGGAAGG + Intronic
1142564030 17:827881-827903 CATCCGAAGCGGTGAGGGGCAGG + Intronic
1144219129 17:13084050-13084072 CATCAGAATTAGTTGGGGCCAGG - Intergenic
1144839847 17:18179173-18179195 CATAGGCAGGAGTTAGGGGCAGG - Exonic
1148469135 17:47882693-47882715 CCTCTGAAGGAGTTGGGAGGAGG + Intergenic
1150683558 17:67302333-67302355 CATCCAGAGGAGTGGGGAGCAGG + Intergenic
1151196594 17:72436036-72436058 CGACAGAAGGAGTTGGGGGGTGG - Intergenic
1152154805 17:78625955-78625977 CCTTCGCTGGAGTTGGGGGCTGG + Intergenic
1159669016 18:71200165-71200187 CATGGGAAGGGGTTGGGGGAGGG - Intergenic
1160668456 19:344559-344581 CAGCCGGGGGAGTTGGGGGGTGG + Intronic
1161978209 19:7617673-7617695 CACACGTGGGAGTTGGGGGCTGG + Intronic
1162737313 19:12753802-12753824 CTTCTGAAGGGGTTGGGGACAGG - Intronic
1162968250 19:14165806-14165828 CTTCCGAAGGAGGTGGGGCAGGG - Intronic
1165892873 19:39125491-39125513 CCCCAGAAGGAGTTAGGGGCTGG - Intergenic
1166793690 19:45413637-45413659 GAACCCAAGGAGTTGGGGGAAGG - Exonic
1167460373 19:49621382-49621404 GGTCCGAAGGAGGAGGGGGCTGG + Intronic
925350468 2:3197779-3197801 CCTCAGGAGGACTTGGGGGCAGG - Intronic
925376530 2:3389657-3389679 CAGCCGAAGGGGGTGGGGGATGG + Intronic
928024507 2:27728707-27728729 CATTGGAAGGAGTAGGGGGATGG - Intergenic
931253164 2:60550923-60550945 CGGCCGGGGGAGTTGGGGGCGGG + Intronic
932004277 2:67912511-67912533 CTTCCAAAGAAGTTGGGGGTGGG - Intergenic
934066603 2:88347502-88347524 CATCTGGAGGGGTTGGGGGCTGG + Intergenic
935455745 2:103265937-103265959 CACCCGAGGGAGTTGGGGGACGG + Intergenic
940854737 2:158721168-158721190 CATCAGAAGCACTTGGGGGAGGG - Intergenic
942027287 2:171922692-171922714 AACCCCAAGCAGTTGGGGGCGGG - Intronic
942227410 2:173829514-173829536 CATCCAAAGGGGTTGGGGCAAGG - Intergenic
942407894 2:175675337-175675359 CATGTGAAGGGGTTGGGGGTGGG - Intergenic
942633744 2:177979146-177979168 CATCCAAAGGGGTTGGGGAAAGG - Intronic
943467072 2:188240959-188240981 CTTCCTGAGGAGTTTGGGGCTGG + Intergenic
948061544 2:235046103-235046125 CATCTGCAGGAGCTGGAGGCCGG - Intronic
1168961066 20:1870332-1870354 CATGCTAAGGTGTTGGGGGTTGG + Intergenic
1172699754 20:36845822-36845844 CAACTGAAGGAGCTGGGGGTGGG + Intronic
1174401552 20:50278602-50278624 CACCCGAAGGAGTTGTGGGAGGG - Intergenic
1174658435 20:52191258-52191280 CATCAGGCGGAGTTTGGGGCGGG - Intronic
1176177822 20:63737034-63737056 CACCCGGAGGAGCTGGAGGCTGG - Intronic
1179565609 21:42246001-42246023 CATCCTAGAGAGGTGGGGGCAGG + Intronic
1180982507 22:19885486-19885508 CAGCCGCAGGAATTGGGTGCCGG + Intronic
1181553418 22:23653843-23653865 CACCCCAAGGAGATGGTGGCAGG + Intergenic
1181901474 22:26159845-26159867 CATCCAACAGAGATGGGGGCAGG + Intergenic
1182424682 22:30265870-30265892 TGTCAGAAGGTGTTGGGGGCGGG + Intronic
1183065698 22:35361269-35361291 CATCAGACGGAGCTGGGTGCTGG - Intergenic
1183830719 22:40417245-40417267 CACCCGGAGGAATAGGGGGCAGG - Intronic
1185046654 22:48531838-48531860 CTTCCGGGGGAGTTGGGGGGTGG - Intronic
1185233707 22:49699125-49699147 CATCAGCAGGATGTGGGGGCAGG + Intergenic
950065507 3:10108397-10108419 CATTCCAATGAGGTGGGGGCGGG - Intergenic
950121255 3:10483842-10483864 CCACGGAAGGACTTGGGGGCCGG + Intronic
952979308 3:38722217-38722239 TATCTGGAGGATTTGGGGGCAGG + Intronic
954135105 3:48578822-48578844 CATCCGAGAGAGTTGGTGGGGGG - Intronic
954391288 3:50269317-50269339 GAGCCGAAGGCGTGGGGGGCTGG - Exonic
959375777 3:105587253-105587275 CATCCAAAGGGGTTGGGGAAAGG + Intergenic
961078361 3:124002989-124003011 CTGCTGAAGGAGGTGGGGGCGGG - Intergenic
962235019 3:133700217-133700239 CATCCTAAGGAGGTGGGGGGTGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
967166463 3:186783986-186784008 CATCCACACGAGTTGGGGGAGGG + Intronic
968289538 3:197527847-197527869 CATCCAAAGGAGGTGCGGGAGGG - Intronic
968454089 4:688532-688554 CACCTGAAGGGGGTGGGGGCAGG + Intronic
969331098 4:6473730-6473752 AGTCCAAAGGCGTTGGGGGCAGG + Intronic
969370912 4:6731142-6731164 CATCAGATGGGGGTGGGGGCGGG + Intergenic
969550384 4:7862380-7862402 CAGGGGCAGGAGTTGGGGGCGGG + Intronic
971268221 4:25113248-25113270 CAACTGGAGGAGGTGGGGGCGGG + Intergenic
971479513 4:27101919-27101941 AATCCTAAGGAGCTGGTGGCTGG + Intergenic
972671602 4:41217260-41217282 CCTCCTAGGGAGTTGGGGGAAGG + Intergenic
978174036 4:105708432-105708454 CCTCCGAGGGAGTTGCGGGCCGG - Intronic
980771066 4:137373975-137373997 CTTCCCAAGGAGTTCTGGGCTGG + Intergenic
995576934 5:113546780-113546802 CATCTGAAGGTTTTTGGGGCTGG + Intronic
996733243 5:126736029-126736051 CATTTGAGGGAGTTGGGGGTTGG + Intergenic
999319798 5:150606850-150606872 CAGGCTCAGGAGTTGGGGGCAGG - Intronic
999324851 5:150637586-150637608 AACCCGCAGGGGTTGGGGGCAGG + Intronic
999776367 5:154815653-154815675 GATGAGGAGGAGTTGGGGGCTGG + Exonic
1001877307 5:175212776-175212798 CGTAAGAAGGAGTTGGAGGCCGG + Intergenic
1003865306 6:10357540-10357562 GGCCGGAAGGAGTTGGGGGCTGG + Intergenic
1007131282 6:39476515-39476537 CATCAGAAGGAGCTGGGCTCTGG + Intronic
1011737037 6:90321312-90321334 CATCTGAATGAGCTGAGGGCTGG - Intergenic
1013514785 6:110875553-110875575 CCTCCGTAGTAGTTGGCGGCAGG + Intronic
1014134389 6:117871274-117871296 AAGCGGAAGGAGTGGGGGGCAGG + Intergenic
1016037168 6:139395414-139395436 CTCCAGAGGGAGTTGGGGGCTGG + Intergenic
1018177023 6:161186131-161186153 CCTCCCAAGAAGTGGGGGGCTGG - Intronic
1021224736 7:18013899-18013921 CTCCCGAAGGAGTTCGGAGCTGG + Intergenic
1021868324 7:24980017-24980039 CGGCCGCAGGAGTCGGGGGCGGG + Exonic
1021998376 7:26201731-26201753 CATCCGAAGGGGGAGGGAGCCGG - Intronic
1026617494 7:71918774-71918796 AATTCCAAGGAGCTGGGGGCTGG - Intronic
1028796521 7:94908660-94908682 CAACCCAAGGAGGCGGGGGCGGG - Intronic
1033314423 7:140285733-140285755 CATCCCAAGGTCTTGGGGACAGG + Intergenic
1035068495 7:156124555-156124577 CAGCACAAGGAGGTGGGGGCGGG - Intergenic
1040999330 8:53434921-53434943 CATCCGAAGGGGATGGGAGAGGG + Intergenic
1042561161 8:70072568-70072590 CACGCGAAGGCGTCGGGGGCGGG - Intergenic
1044496307 8:92888732-92888754 CATCCCAAGGGGTTGTGGGCAGG + Intronic
1044842835 8:96352193-96352215 CATCCAAAGGAGTTGAAGTCAGG - Intergenic
1047517747 8:125569726-125569748 GGTCCCAAGGAATTGGGGGCTGG + Intergenic
1049334604 8:142076527-142076549 CATGAGAAGGAGCCGGGGGCAGG - Intergenic
1053007922 9:34616274-34616296 CATCCAGGAGAGTTGGGGGCAGG - Intronic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1053449206 9:38179278-38179300 CGTCCCCAGGAGTTTGGGGCAGG + Intergenic
1060302567 9:122383799-122383821 CATCCTGAGAAGTTGGGGGCGGG + Intronic
1061182633 9:129034110-129034132 CCTCCCAAGTATTTGGGGGCAGG + Intergenic
1062083145 9:134635017-134635039 CATCCGACGAAGGTGAGGGCAGG - Intergenic
1062345259 9:136111455-136111477 CTTCGGAGGGAGTTGGGAGCCGG - Intergenic
1186349620 X:8729282-8729304 CATTTGCAGGAGTTGGGGGCGGG + Intronic
1190879757 X:54483840-54483862 CATCTAAAGGACTTGGGGCCTGG - Intronic
1191842539 X:65523559-65523581 CATCCGAAGGAGTTGGGGGCTGG + Exonic
1191865244 X:65698568-65698590 CAGCAGAAGCAGTGGGGGGCAGG - Intronic
1194000727 X:88425454-88425476 AATCCAAATGAGTTGGTGGCAGG - Intergenic
1201675995 Y:16584855-16584877 CATCTGAATGAGTTGCTGGCTGG + Intergenic