ID: 1191842543

View in Genome Browser
Species Human (GRCh38)
Location X:65523583-65523605
Sequence CCTGCTTGGGCTCACCTTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191842543_1191842549 -7 Left 1191842543 X:65523583-65523605 CCAGCAAGGTGAGCCCAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1191842549 X:65523599-65523621 AAGCAGGACTCAACCATCCGGGG 0: 1
1: 0
2: 1
3: 3
4: 82
1191842543_1191842550 3 Left 1191842543 X:65523583-65523605 CCAGCAAGGTGAGCCCAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1191842550 X:65523609-65523631 CAACCATCCGGGGCCAGTCAAGG 0: 1
1: 0
2: 0
3: 8
4: 169
1191842543_1191842553 7 Left 1191842543 X:65523583-65523605 CCAGCAAGGTGAGCCCAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1191842553 X:65523613-65523635 CATCCGGGGCCAGTCAAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 84
1191842543_1191842551 4 Left 1191842543 X:65523583-65523605 CCAGCAAGGTGAGCCCAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1191842551 X:65523610-65523632 AACCATCCGGGGCCAGTCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1191842543_1191842555 10 Left 1191842543 X:65523583-65523605 CCAGCAAGGTGAGCCCAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1191842555 X:65523616-65523638 CCGGGGCCAGTCAAGGGAGGCGG 0: 1
1: 0
2: 5
3: 132
4: 1131
1191842543_1191842547 -9 Left 1191842543 X:65523583-65523605 CCAGCAAGGTGAGCCCAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1191842547 X:65523597-65523619 CCAAGCAGGACTCAACCATCCGG 0: 1
1: 0
2: 2
3: 11
4: 395
1191842543_1191842548 -8 Left 1191842543 X:65523583-65523605 CCAGCAAGGTGAGCCCAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1191842548 X:65523598-65523620 CAAGCAGGACTCAACCATCCGGG 0: 1
1: 0
2: 1
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191842543 Original CRISPR CCTGCTTGGGCTCACCTTGC TGG (reversed) Exonic
901062316 1:6477514-6477536 CCCGCCTGTGCTCACCTTGTGGG + Exonic
901333016 1:8424833-8424855 CCTGCTGGAGCCCACCTGGCAGG - Intronic
901469253 1:9444248-9444270 CCTGCCTGTGCTCATCCTGCAGG - Intergenic
901745924 1:11373400-11373422 CCTGCTTGGGCCTCCCTTGTGGG - Intergenic
901759771 1:11463200-11463222 CCTGCTTGTGGGCTCCTTGCTGG + Intergenic
901776448 1:11563501-11563523 CCTGCATGTGCTCTCCCTGCTGG - Intergenic
902698151 1:18154231-18154253 TCTGCCTGGGCTCTCCTTACAGG + Intronic
902919143 1:19656287-19656309 CCAGCTGAGGCTCACCCTGCAGG - Intronic
903233525 1:21935998-21936020 CCTGCCTGGCCTCACCTTCCTGG - Intronic
903307139 1:22420855-22420877 CCTGTTTGGACTCACCTGGCTGG - Intergenic
903340006 1:22647833-22647855 CCTGCATGGACCCACCTTACTGG + Exonic
905050503 1:35046971-35046993 CCTGTGTGGGCTCACGTTCCTGG - Intergenic
912689724 1:111795249-111795271 ACTGCTGGGGCTCACTTTGCAGG - Intronic
912994555 1:114520054-114520076 CCTTCTTGGGCTATCCGTGCTGG - Intergenic
916573576 1:166048091-166048113 CCTGCTTGGGTTCATCTTACGGG + Intergenic
918048117 1:180953533-180953555 CCTGCTTGTGCTCACCTGCCCGG - Intergenic
918736137 1:188065874-188065896 CCTGATGGGGCTCCCTTTGCAGG + Intergenic
919866450 1:201786627-201786649 CCTGCCTTGCCTCACCCTGCAGG - Intronic
1063955024 10:11257629-11257651 CGTGCTTGGTCTCACATGGCTGG + Intronic
1067498069 10:46776289-46776311 CTTGCTTGCGCTCACCTCGGGGG + Intergenic
1067596577 10:47564125-47564147 CTTGCTTGCGCTCACCTCGGGGG - Intergenic
1068757045 10:60667936-60667958 CTTGCTTGGGTTCAGATTGCTGG + Intronic
1071546428 10:86533401-86533423 TCTGCTTGGGCTCACTTTCTAGG + Intergenic
1071656904 10:87458855-87458877 CCTGCTTGGGATCCCCAAGCAGG + Intergenic
1074227919 10:111505592-111505614 ACTGCTTGTGCTCACCTGCCAGG - Intergenic
1074365549 10:112854896-112854918 CCAGCTGGGGCTCTCCTTCCGGG + Intergenic
1076141007 10:128078465-128078487 CCTGCTTGGAAGAACCTTGCCGG - Intronic
1076821576 10:132942421-132942443 CGGGCCTGGGGTCACCTTGCTGG + Exonic
1078912834 11:15749360-15749382 CCTTCTTGAGCTCACCTTCCAGG - Intergenic
1079451640 11:20603938-20603960 CCTGCTTGCAATCACCTTACAGG + Intronic
1079967312 11:26994748-26994770 CCTGCTGAGCCTCACCCTGCGGG + Exonic
1083810838 11:65105798-65105820 CCTCTTTGGGCTCAGTTTGCTGG + Intronic
1084006537 11:66326339-66326361 TCTGCTTGGGTTCCCCTTCCCGG - Intergenic
1084452244 11:69246100-69246122 CCAGCCTGAGCCCACCTTGCAGG + Intergenic
1084499406 11:69525879-69525901 CCTGCATGGGCTCTCCTAGTTGG - Intergenic
1085731414 11:79002121-79002143 CCTGGTTGTGCTGCCCTTGCTGG + Intronic
1086529250 11:87764357-87764379 CCTGCTTTGGCTCACGCTGGTGG + Intergenic
1087907640 11:103717636-103717658 CCTGCTTGGGTTCCCTTTGTAGG - Intergenic
1089615222 11:119691323-119691345 CCAGCTTGGGGTCACCCTGGAGG + Intronic
1090625937 11:128608921-128608943 TCTGCCTGGGCTCAGCTTCCAGG + Intergenic
1091907030 12:4197247-4197269 CCTCCTCAGGCTCACCTTCCTGG + Intergenic
1092174603 12:6394522-6394544 CCTTGTTGGGCTGACCCTGCCGG - Intergenic
1094045687 12:26163910-26163932 ACTGCTTTTGCTCACCTTGGTGG - Intronic
1094106938 12:26823080-26823102 CCTGATTGGGATGACCTGGCGGG - Intronic
1099113041 12:78586838-78586860 GCTGCTTGTGCACACCTTGTGGG - Intergenic
1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG + Exonic
1103106891 12:118235557-118235579 CCTTCGTGGGCACACCTTACTGG - Exonic
1103528265 12:121581561-121581583 CCTGCTAGGCCTGATCTTGCGGG + Intergenic
1104894267 12:132154078-132154100 CCTGCTAGGTTTCACCTCGCCGG + Intergenic
1105284542 13:18993610-18993632 CCTTCCTGGTCTCTCCTTGCTGG - Intergenic
1106592719 13:31111040-31111062 GTTGCTTGAGCTCTCCTTGCCGG + Intergenic
1107818700 13:44267071-44267093 CCTGCATTGGCTGTCCTTGCGGG - Intergenic
1109016505 13:57021476-57021498 CTGGCTTGGGCTCACATTTCAGG - Intergenic
1109180783 13:59211998-59212020 CCTACTGGGGCCCACCTGGCAGG - Intergenic
1111964503 13:94847221-94847243 CCTGCTTAGCCTCACCTCTCGGG - Intergenic
1113639376 13:111946293-111946315 GCTCCATGTGCTCACCTTGCAGG - Intergenic
1115359898 14:32488811-32488833 CCTGCTTCTGCTCCCCTTGGTGG + Intronic
1115650680 14:35400871-35400893 CCTGTCTAGGGTCACCTTGCAGG - Intergenic
1116178253 14:41501291-41501313 CTTGCTTGGGCTAAATTTGCGGG - Intergenic
1117899550 14:60517475-60517497 CATGCTTAGGCTCACCTAGGGGG + Intergenic
1118332632 14:64825759-64825781 CCTGCTCAGGCTCATCTTTCTGG - Intronic
1119457192 14:74766052-74766074 CCTGCTTGTGCTCACCCATCTGG + Intronic
1120551455 14:85877758-85877780 CCTGTTTGGGATCACATTTCCGG + Intergenic
1121049852 14:90813153-90813175 CCTTCTTGGGGACACCTTTCAGG + Intronic
1121902643 14:97707888-97707910 TCGGCTTTGGCTCACCCTGCTGG - Intergenic
1122215611 14:100201947-100201969 CTTCCCTGGGCTCACATTGCAGG - Intergenic
1122691796 14:103535137-103535159 CCTGCTTAGGCCCACCTGGGAGG - Exonic
1202850922 14_GL000225v1_random:18551-18573 CTTGCTTGTGCTCTCCCTGCAGG - Intergenic
1125767590 15:42145751-42145773 CCAGCCTCGACTCACCTTGCAGG + Exonic
1126520965 15:49593162-49593184 CCTGCTTTGGCTCACCTCCGAGG + Intronic
1128333496 15:66771417-66771439 CCTGCTTGGCCCCACCTCTCTGG - Intronic
1128341552 15:66825905-66825927 CCTGCCGGGGCCCACCTTGCAGG + Intergenic
1129056962 15:72826848-72826870 CATGCTAGGGCTCACATTGAGGG + Intergenic
1129838915 15:78731426-78731448 CCTCCTTGGGCTCATGTTTCTGG + Intergenic
1130038167 15:80380371-80380393 CCTTCTTGGCCTCAGCTTGCTGG - Intronic
1130737554 15:86566098-86566120 CCTGCTTTGGCTCACCTCGTTGG + Intronic
1131092587 15:89633605-89633627 CCTGCCTGGGCTCCCCTGGCTGG + Intronic
1131516394 15:93080440-93080462 CCTGCTTGAGGTCACCCAGCAGG + Intronic
1132354794 15:101163255-101163277 CCTGGCTGGACTCACCTTGGAGG - Intergenic
1132871802 16:2118688-2118710 TCTGCTTGGCATCCCCTTGCTGG - Exonic
1133422729 16:5660769-5660791 CCTGCTTCAGCTCACCTCTCCGG - Intergenic
1134014145 16:10877101-10877123 ACCGCTTGGGGCCACCTTGCAGG + Intergenic
1134520726 16:14918208-14918230 TCTGCTTGGCATCCCCTTGCTGG + Intronic
1134550850 16:15137766-15137788 TCTGCTTGGCATCCCCTTGCTGG - Intronic
1134708398 16:16316859-16316881 TCTGCTTGGCATCCCCTTGCTGG + Intergenic
1134715613 16:16356892-16356914 TCTGCTTGGCATCCCCTTGCTGG + Intergenic
1134951204 16:18351786-18351808 TCTGCTTGGCATCCCCTTGCTGG - Intergenic
1134959144 16:18395267-18395289 TCTGCTTGGCATCCCCTTGCTGG - Intergenic
1135063891 16:19292960-19292982 CCTGCTTTGTCTCACCTCCCAGG - Intronic
1136377547 16:29874292-29874314 CCATGTTGGGCTCACCCTGCTGG - Intronic
1137236932 16:46624622-46624644 AGTGCCTGGGCTCCCCTTGCAGG - Intergenic
1137249390 16:46731167-46731189 TCTGGTTGGGCTCAGCTGGCAGG - Intronic
1138348392 16:56333731-56333753 CCTGCTGGGGGCCAGCTTGCTGG - Intronic
1138690958 16:58768318-58768340 CCTGCTGGGGCTCAGCTGGGAGG + Intergenic
1139956390 16:70695072-70695094 CCTGCTCTGGCTGGCCTTGCAGG + Intronic
1203116079 16_KI270728v1_random:1491847-1491869 CCTCCTGGTGCTCACCCTGCAGG - Intergenic
1143917059 17:10301885-10301907 ACTGCCTCGGATCACCTTGCAGG + Intronic
1146642120 17:34549369-34549391 CCTGCTTGGGGCCACCTCCCTGG - Intergenic
1147245735 17:39119263-39119285 ACTGCCTGGGCTCACCCTGGAGG - Intronic
1147323723 17:39660519-39660541 CCAGACTGGGCTCACCTGGCAGG - Exonic
1148122230 17:45220253-45220275 TCTGCTTTGACTCACCTTGGAGG + Intergenic
1148122389 17:45221076-45221098 CCTCCTTGGGACCACCTTGGCGG + Intergenic
1148355471 17:46972650-46972672 TCTCCTGGGGCTCACTTTGCAGG - Intronic
1151571323 17:74927313-74927335 CGTGCTGGTGTTCACCTTGCAGG + Intronic
1152261521 17:79269828-79269850 AGTGGTGGGGCTCACCTTGCTGG - Intronic
1157584619 18:48793161-48793183 CCTCCCTGGGATCCCCTTGCAGG + Intronic
1158382669 18:56951086-56951108 CCAGCTTGGTCTCACCGTTCAGG + Intronic
1161542677 19:4861440-4861462 CCTGCCTGGCCCCACCTTCCAGG + Intronic
1161679955 19:5675062-5675084 CCTGCCTCATCTCACCTTGCAGG - Intronic
1161902073 19:7126363-7126385 CCTGAATGGGCTCATCTAGCCGG - Intronic
1163746386 19:19051227-19051249 CCTGGTTGGGCTCAACTGGATGG + Intronic
1165271010 19:34707722-34707744 ACTGCTTGTGCTGGCCTTGCTGG - Intergenic
1165425073 19:35740981-35741003 CTTGCTTGGGCGGAGCTTGCAGG - Intronic
1167698894 19:51030773-51030795 CCTGCACTGGCTCACCTGGCAGG + Exonic
1168663636 19:58185909-58185931 TCTGCTTGGGCTCACACTGCAGG + Intronic
929788262 2:45007075-45007097 CCTGTGAGGGCTCTCCTTGCTGG + Intronic
929940816 2:46332779-46332801 CCTGCTTGGACTCAGATTTCTGG - Intronic
932339156 2:70948883-70948905 CCTACTTGGTCACACCTTGCTGG + Intronic
935157202 2:100493960-100493982 CCAGCTTGGCCTCTCCTTCCAGG - Intergenic
936451693 2:112638549-112638571 CCTGCCAGGGCCCACCGTGCAGG + Intergenic
937132631 2:119524553-119524575 CCAGCTTGGGCCCAGCCTGCGGG - Intergenic
940249908 2:151663781-151663803 CCAGCTTGGGGTCATCTTCCAGG + Exonic
947748337 2:232520688-232520710 CCAGCCTGGACTTACCTTGCAGG - Exonic
1171390456 20:24798452-24798474 CTGGCCTGGGCTCAGCTTGCGGG - Intergenic
1173543907 20:43877114-43877136 CCTGCTTTGGCTCACACTCCGGG + Intergenic
1173793503 20:45842973-45842995 CCTGCTTGGACCTTCCTTGCAGG - Intronic
1175997753 20:62819026-62819048 CCTGCTTGCCCACACCTTGCTGG - Intronic
1176013444 20:62913393-62913415 CTTGCCTGGGGTCACCTGGCTGG - Intronic
1178582883 21:33850871-33850893 GGTGCATGGGCTCACCTGGCAGG + Intronic
1179585962 21:42374244-42374266 CTTGCTCCTGCTCACCTTGCTGG - Intronic
1182859039 22:33543230-33543252 ACTACTTGGGCTCACCATCCTGG - Intronic
1183180809 22:36258451-36258473 CCTGTTTGGGTTTACCTTGTTGG + Intronic
1184491740 22:44813940-44813962 CCTGCGTGGGGTCAGCCTGCAGG - Intronic
949554723 3:5143116-5143138 CCTGCCAGGTCTCACCTTGTGGG - Intronic
949563748 3:5226522-5226544 CCTGCTCGGGCTCGCCTGGGTGG + Intergenic
950119142 3:10470351-10470373 CCTGCTTAAGATCACCTAGCTGG + Intronic
950156469 3:10724865-10724887 TCTGGTTGAGCTCACTTTGCTGG - Intergenic
950222182 3:11204910-11204932 CCTGGTTGGGCTCTCCCTGCAGG - Intronic
950399786 3:12761066-12761088 ACTTCTTGGGCTAACCTTTCAGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
960567902 3:119155010-119155032 CCTGATTGGGTTCCCCTTGTAGG + Intronic
960993490 3:123326408-123326430 CCTGCTTCAGCTGACATTGCTGG + Intronic
961750051 3:129089319-129089341 AGTGCCTGGGCTCCCCTTGCAGG - Exonic
965669115 3:171128428-171128450 AATGCTTGTTCTCACCTTGCAGG + Intronic
971302898 4:25456500-25456522 CCTGCTTGCCTTCACCCTGCAGG + Intergenic
983830581 4:172321951-172321973 CATGCTTGGGCTCACTTGCCCGG - Intronic
991475928 5:67019324-67019346 CCTGGATGGGCTCACATTTCAGG + Intronic
991498539 5:67252431-67252453 CCTGCCTGGACTCAGCTTCCAGG - Intergenic
995203866 5:109457414-109457436 CCTGCTTCGGCTCACGCTGGAGG - Intergenic
995395041 5:111678476-111678498 CCAGCTTGTGCTCACCGTGTTGG + Intronic
998967989 5:147561324-147561346 CCTGGGTGGGCTCAGCTTGGGGG + Intergenic
1003046807 6:2740658-2740680 CATGCTTGGGCTCTGCTTTCTGG + Intronic
1003281032 6:4691462-4691484 CCTGGCTGTGGTCACCTTGCTGG + Intergenic
1006129440 6:31860468-31860490 CCTGCTTGGGCTGACCGTAGGGG + Exonic
1007242445 6:40436743-40436765 CCTTCTTGGTCTCTACTTGCTGG + Intronic
1008763506 6:54882509-54882531 CCTGCTTGGGCTTACCATTATGG + Intronic
1016429314 6:143965782-143965804 CCTTCTTGGTCTCACCTGTCTGG - Exonic
1018533552 6:164794447-164794469 CCAGGTTGGGATCATCTTGCGGG - Intergenic
1019309309 7:352535-352557 TCGGCTTGGCCTCACCTTGGAGG - Intergenic
1021355927 7:19653192-19653214 CCTGATTGGGTTCCCTTTGCAGG - Intergenic
1022613027 7:31896056-31896078 CCTTCATGAGCTCACCCTGCTGG - Intronic
1024397671 7:48887959-48887981 GCTGTTTGGCCTCACCTAGCTGG + Intergenic
1025751352 7:64296397-64296419 CCTGCTTGGGCCCTGCTTACAGG - Intergenic
1026602171 7:71785876-71785898 CCTCCTTGGTCTGGCCTTGCTGG + Exonic
1026658407 7:72277317-72277339 CCTGTATGGGCTCACTTTGGAGG + Intronic
1027423510 7:78040255-78040277 CTTCCTTTGGATCACCTTGCAGG + Intronic
1029513589 7:101012228-101012250 GGTGCTTGGGCTCCACTTGCTGG + Intronic
1035048469 7:155984354-155984376 CGTGATTGAGCTCACCCTGCAGG + Intergenic
1038290435 8:26244461-26244483 CCAGATTGGTCTCACATTGCTGG - Intergenic
1038663898 8:29520817-29520839 CCTGCCAGGACTCTCCTTGCAGG + Intergenic
1045384466 8:101658046-101658068 CCTGCCTGGTCTCACTTTCCAGG + Intronic
1046828215 8:118715314-118715336 TCTCCTAGGGCTCACCATGCTGG + Intergenic
1048950318 8:139491487-139491509 CCTTCTTGGGCTCCACTTGTAGG - Intergenic
1049625302 8:143617247-143617269 CCTGCTCGGGCTCCCCCGGCAGG + Intronic
1052777231 9:32744074-32744096 CCTGCTTGGCTTCACCATTCTGG - Intergenic
1053887499 9:42655102-42655124 CCTGCTTGGGCAAAACTTGATGG + Intergenic
1054226521 9:62462552-62462574 CCTGCTTGGGCAAAACTTGATGG + Intergenic
1055368723 9:75574022-75574044 TCTGCTTGGGCCCACCTAGTTGG - Intergenic
1057610669 9:96540716-96540738 CCTGCATGAGCCCACCTGGCAGG + Intronic
1057801105 9:98192104-98192126 CCTGCTGGGCCTCAGCTTCCTGG - Intronic
1061007764 9:127937925-127937947 CCTGCTCGGGCCCACCTCGTCGG + Exonic
1061989148 9:134148744-134148766 TCTGCTTGGGTTCACCTGCCCGG - Intronic
1062267692 9:135694948-135694970 CCTGCTTGGGCCCACTTTCTCGG - Intronic
1189760935 X:44320838-44320860 CCTGTTAGGCCTTACCTTGCAGG + Intronic
1191842543 X:65523583-65523605 CCTGCTTGGGCTCACCTTGCTGG - Exonic
1191974012 X:66850591-66850613 CCTGTTTGTGCTCATCTTTCTGG + Intergenic
1192151841 X:68717586-68717608 TATGCTTGGGCTCTGCTTGCTGG - Exonic
1195239838 X:102939983-102940005 CCTGCATGTGCCCACCTTACTGG + Intergenic
1197775228 X:130114445-130114467 CTGGCTTGGGCTCACCCAGCAGG - Intergenic
1199474098 X:148227252-148227274 CCTGCCAGGGCCCAACTTGCAGG + Intergenic
1199508463 X:148592827-148592849 CCTGCCTGGGCTCAGCTGGGAGG - Intronic
1200912402 Y:8542608-8542630 CCAGCTTGGTCTCACCTCCCAGG - Intergenic