ID: 1191845294

View in Genome Browser
Species Human (GRCh38)
Location X:65542754-65542776
Sequence GAACCCTGAATAGCTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191845294_1191845296 13 Left 1191845294 X:65542754-65542776 CCTGTCTCAGCTATTCAGGGTTC No data
Right 1191845296 X:65542790-65542812 TAGTGATGTTATTGCTTCCCAGG No data
1191845294_1191845297 25 Left 1191845294 X:65542754-65542776 CCTGTCTCAGCTATTCAGGGTTC No data
Right 1191845297 X:65542802-65542824 TGCTTCCCAGGAGCAATTTGAGG No data
1191845294_1191845298 28 Left 1191845294 X:65542754-65542776 CCTGTCTCAGCTATTCAGGGTTC No data
Right 1191845298 X:65542805-65542827 TTCCCAGGAGCAATTTGAGGAGG No data
1191845294_1191845299 29 Left 1191845294 X:65542754-65542776 CCTGTCTCAGCTATTCAGGGTTC No data
Right 1191845299 X:65542806-65542828 TCCCAGGAGCAATTTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191845294 Original CRISPR GAACCCTGAATAGCTGAGAC AGG (reversed) Intergenic
No off target data available for this crispr