ID: 1191846288

View in Genome Browser
Species Human (GRCh38)
Location X:65550324-65550346
Sequence CTGGGCCACCACTCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191846288_1191846295 -9 Left 1191846288 X:65550324-65550346 CCCTCCTCAGAGTGGTGGCCCAG No data
Right 1191846295 X:65550338-65550360 GTGGCCCAGCCTGGCAGTGGGGG No data
1191846288_1191846296 -8 Left 1191846288 X:65550324-65550346 CCCTCCTCAGAGTGGTGGCCCAG No data
Right 1191846296 X:65550339-65550361 TGGCCCAGCCTGGCAGTGGGGGG No data
1191846288_1191846301 7 Left 1191846288 X:65550324-65550346 CCCTCCTCAGAGTGGTGGCCCAG No data
Right 1191846301 X:65550354-65550376 GTGGGGGGTGGAGCACCAGCAGG No data
1191846288_1191846303 14 Left 1191846288 X:65550324-65550346 CCCTCCTCAGAGTGGTGGCCCAG No data
Right 1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG No data
1191846288_1191846302 10 Left 1191846288 X:65550324-65550346 CCCTCCTCAGAGTGGTGGCCCAG No data
Right 1191846302 X:65550357-65550379 GGGGGTGGAGCACCAGCAGGAGG No data
1191846288_1191846306 25 Left 1191846288 X:65550324-65550346 CCCTCCTCAGAGTGGTGGCCCAG No data
Right 1191846306 X:65550372-65550394 GCAGGAGGAAGGCAGGAAACTGG No data
1191846288_1191846294 -10 Left 1191846288 X:65550324-65550346 CCCTCCTCAGAGTGGTGGCCCAG No data
Right 1191846294 X:65550337-65550359 GGTGGCCCAGCCTGGCAGTGGGG No data
1191846288_1191846298 -5 Left 1191846288 X:65550324-65550346 CCCTCCTCAGAGTGGTGGCCCAG No data
Right 1191846298 X:65550342-65550364 CCCAGCCTGGCAGTGGGGGGTGG No data
1191846288_1191846304 18 Left 1191846288 X:65550324-65550346 CCCTCCTCAGAGTGGTGGCCCAG No data
Right 1191846304 X:65550365-65550387 AGCACCAGCAGGAGGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191846288 Original CRISPR CTGGGCCACCACTCTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr