ID: 1191849018

View in Genome Browser
Species Human (GRCh38)
Location X:65571896-65571918
Sequence GATTCTGAGCAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191849006_1191849018 18 Left 1191849006 X:65571855-65571877 CCCTGGGTATATTGGGTGCACAG No data
Right 1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG No data
1191849013_1191849018 -7 Left 1191849013 X:65571880-65571902 CCCAAATGTGGGGTGAGATTCTG No data
Right 1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG No data
1191849007_1191849018 17 Left 1191849007 X:65571856-65571878 CCTGGGTATATTGGGTGCACAGG No data
Right 1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG No data
1191849005_1191849018 23 Left 1191849005 X:65571850-65571872 CCACACCCTGGGTATATTGGGTG No data
Right 1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG No data
1191849014_1191849018 -8 Left 1191849014 X:65571881-65571903 CCAAATGTGGGGTGAGATTCTGA No data
Right 1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191849018 Original CRISPR GATTCTGAGCAGAGGGAGGA AGG Intergenic
No off target data available for this crispr