ID: 1191850168

View in Genome Browser
Species Human (GRCh38)
Location X:65580500-65580522
Sequence CATAGCTCTGTGAAGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191850168_1191850178 20 Left 1191850168 X:65580500-65580522 CCTGCCAACTTCACAGAGCTATG No data
Right 1191850178 X:65580543-65580565 ATCCAGGTGGTAACCTATTATGG No data
1191850168_1191850174 -5 Left 1191850168 X:65580500-65580522 CCTGCCAACTTCACAGAGCTATG No data
Right 1191850174 X:65580518-65580540 CTATGGGGGTGCTAATTAGATGG No data
1191850168_1191850176 7 Left 1191850168 X:65580500-65580522 CCTGCCAACTTCACAGAGCTATG No data
Right 1191850176 X:65580530-65580552 TAATTAGATGGCCATCCAGGTGG No data
1191850168_1191850175 4 Left 1191850168 X:65580500-65580522 CCTGCCAACTTCACAGAGCTATG No data
Right 1191850175 X:65580527-65580549 TGCTAATTAGATGGCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191850168 Original CRISPR CATAGCTCTGTGAAGTTGGC AGG (reversed) Intergenic
No off target data available for this crispr