ID: 1191850244

View in Genome Browser
Species Human (GRCh38)
Location X:65581007-65581029
Sequence GGCTGCTGGCAGGCTGGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191850244_1191850254 24 Left 1191850244 X:65581007-65581029 CCACAACCAGCCTGCCAGCAGCC No data
Right 1191850254 X:65581054-65581076 GGACAAATTCCTAGAACTCACGG No data
1191850244_1191850248 -10 Left 1191850244 X:65581007-65581029 CCACAACCAGCCTGCCAGCAGCC No data
Right 1191850248 X:65581020-65581042 GCCAGCAGCCAGCTCACTCAGGG No data
1191850244_1191850251 3 Left 1191850244 X:65581007-65581029 CCACAACCAGCCTGCCAGCAGCC No data
Right 1191850251 X:65581033-65581055 TCACTCAGGGCCTCATCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191850244 Original CRISPR GGCTGCTGGCAGGCTGGTTG TGG (reversed) Intergenic