ID: 1191850245

View in Genome Browser
Species Human (GRCh38)
Location X:65581013-65581035
Sequence TGAGCTGGCTGCTGGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191850245_1191850254 18 Left 1191850245 X:65581013-65581035 CCAGCCTGCCAGCAGCCAGCTCA No data
Right 1191850254 X:65581054-65581076 GGACAAATTCCTAGAACTCACGG No data
1191850245_1191850256 27 Left 1191850245 X:65581013-65581035 CCAGCCTGCCAGCAGCCAGCTCA No data
Right 1191850256 X:65581063-65581085 CCTAGAACTCACGGCCCAGATGG No data
1191850245_1191850257 28 Left 1191850245 X:65581013-65581035 CCAGCCTGCCAGCAGCCAGCTCA No data
Right 1191850257 X:65581064-65581086 CTAGAACTCACGGCCCAGATGGG No data
1191850245_1191850251 -3 Left 1191850245 X:65581013-65581035 CCAGCCTGCCAGCAGCCAGCTCA No data
Right 1191850251 X:65581033-65581055 TCACTCAGGGCCTCATCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191850245 Original CRISPR TGAGCTGGCTGCTGGCAGGC TGG (reversed) Intergenic