ID: 1191850249

View in Genome Browser
Species Human (GRCh38)
Location X:65581021-65581043
Sequence GCCCTGAGTGAGCTGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191850249_1191850256 19 Left 1191850249 X:65581021-65581043 CCAGCAGCCAGCTCACTCAGGGC No data
Right 1191850256 X:65581063-65581085 CCTAGAACTCACGGCCCAGATGG No data
1191850249_1191850254 10 Left 1191850249 X:65581021-65581043 CCAGCAGCCAGCTCACTCAGGGC No data
Right 1191850254 X:65581054-65581076 GGACAAATTCCTAGAACTCACGG No data
1191850249_1191850257 20 Left 1191850249 X:65581021-65581043 CCAGCAGCCAGCTCACTCAGGGC No data
Right 1191850257 X:65581064-65581086 CTAGAACTCACGGCCCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191850249 Original CRISPR GCCCTGAGTGAGCTGGCTGC TGG (reversed) Intergenic
No off target data available for this crispr