ID: 1191850250

View in Genome Browser
Species Human (GRCh38)
Location X:65581028-65581050
Sequence GGATGAGGCCCTGAGTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191850250_1191850254 3 Left 1191850250 X:65581028-65581050 CCAGCTCACTCAGGGCCTCATCC No data
Right 1191850254 X:65581054-65581076 GGACAAATTCCTAGAACTCACGG No data
1191850250_1191850256 12 Left 1191850250 X:65581028-65581050 CCAGCTCACTCAGGGCCTCATCC No data
Right 1191850256 X:65581063-65581085 CCTAGAACTCACGGCCCAGATGG No data
1191850250_1191850257 13 Left 1191850250 X:65581028-65581050 CCAGCTCACTCAGGGCCTCATCC No data
Right 1191850257 X:65581064-65581086 CTAGAACTCACGGCCCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191850250 Original CRISPR GGATGAGGCCCTGAGTGAGC TGG (reversed) Intergenic