ID: 1191850254

View in Genome Browser
Species Human (GRCh38)
Location X:65581054-65581076
Sequence GGACAAATTCCTAGAACTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191850244_1191850254 24 Left 1191850244 X:65581007-65581029 CCACAACCAGCCTGCCAGCAGCC No data
Right 1191850254 X:65581054-65581076 GGACAAATTCCTAGAACTCACGG No data
1191850249_1191850254 10 Left 1191850249 X:65581021-65581043 CCAGCAGCCAGCTCACTCAGGGC No data
Right 1191850254 X:65581054-65581076 GGACAAATTCCTAGAACTCACGG No data
1191850250_1191850254 3 Left 1191850250 X:65581028-65581050 CCAGCTCACTCAGGGCCTCATCC No data
Right 1191850254 X:65581054-65581076 GGACAAATTCCTAGAACTCACGG No data
1191850246_1191850254 14 Left 1191850246 X:65581017-65581039 CCTGCCAGCAGCCAGCTCACTCA No data
Right 1191850254 X:65581054-65581076 GGACAAATTCCTAGAACTCACGG No data
1191850245_1191850254 18 Left 1191850245 X:65581013-65581035 CCAGCCTGCCAGCAGCCAGCTCA No data
Right 1191850254 X:65581054-65581076 GGACAAATTCCTAGAACTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191850254 Original CRISPR GGACAAATTCCTAGAACTCA CGG Intergenic