ID: 1191850256

View in Genome Browser
Species Human (GRCh38)
Location X:65581063-65581085
Sequence CCTAGAACTCACGGCCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191850253_1191850256 -9 Left 1191850253 X:65581049-65581071 CCTTTGGACAAATTCCTAGAACT No data
Right 1191850256 X:65581063-65581085 CCTAGAACTCACGGCCCAGATGG No data
1191850252_1191850256 -3 Left 1191850252 X:65581043-65581065 CCTCATCCTTTGGACAAATTCCT No data
Right 1191850256 X:65581063-65581085 CCTAGAACTCACGGCCCAGATGG No data
1191850250_1191850256 12 Left 1191850250 X:65581028-65581050 CCAGCTCACTCAGGGCCTCATCC No data
Right 1191850256 X:65581063-65581085 CCTAGAACTCACGGCCCAGATGG No data
1191850245_1191850256 27 Left 1191850245 X:65581013-65581035 CCAGCCTGCCAGCAGCCAGCTCA No data
Right 1191850256 X:65581063-65581085 CCTAGAACTCACGGCCCAGATGG No data
1191850249_1191850256 19 Left 1191850249 X:65581021-65581043 CCAGCAGCCAGCTCACTCAGGGC No data
Right 1191850256 X:65581063-65581085 CCTAGAACTCACGGCCCAGATGG No data
1191850246_1191850256 23 Left 1191850246 X:65581017-65581039 CCTGCCAGCAGCCAGCTCACTCA No data
Right 1191850256 X:65581063-65581085 CCTAGAACTCACGGCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191850256 Original CRISPR CCTAGAACTCACGGCCCAGA TGG Intergenic