ID: 1191850413

View in Genome Browser
Species Human (GRCh38)
Location X:65581954-65581976
Sequence TAGCCCCAGCTGCTCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191850413_1191850415 -7 Left 1191850413 X:65581954-65581976 CCTGCCTGGAGCAGCTGGGGCTA No data
Right 1191850415 X:65581970-65581992 GGGGCTACTTGAATATTCTGCGG No data
1191850413_1191850416 -6 Left 1191850413 X:65581954-65581976 CCTGCCTGGAGCAGCTGGGGCTA No data
Right 1191850416 X:65581971-65581993 GGGCTACTTGAATATTCTGCGGG No data
1191850413_1191850418 8 Left 1191850413 X:65581954-65581976 CCTGCCTGGAGCAGCTGGGGCTA No data
Right 1191850418 X:65581985-65582007 TTCTGCGGGATATTCCTGGAAGG No data
1191850413_1191850417 4 Left 1191850413 X:65581954-65581976 CCTGCCTGGAGCAGCTGGGGCTA No data
Right 1191850417 X:65581981-65582003 AATATTCTGCGGGATATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191850413 Original CRISPR TAGCCCCAGCTGCTCCAGGC AGG (reversed) Intergenic
No off target data available for this crispr