ID: 1191852370

View in Genome Browser
Species Human (GRCh38)
Location X:65594953-65594975
Sequence CATTACATGCTGGAGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191852370 Original CRISPR CATTACATGCTGGAGGTGTA GGG (reversed) Intronic
902301730 1:15506915-15506937 CATTTCATGGTGGAGGTGAAGGG - Exonic
904300009 1:29548164-29548186 GATTACATGCTGAGGGTGGAGGG + Intergenic
905445088 1:38022514-38022536 CATCACATTCTGGAGCTGAAAGG - Intronic
906164402 1:43675166-43675188 CAGCACATGTTGGAGGTGGAGGG - Intronic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
910831527 1:91466400-91466422 CATTCCAAGTTGCAGGTGTAGGG + Intergenic
916211694 1:162364988-162365010 CATGCCATGTTGGAGGTGGAAGG - Intronic
917581297 1:176380704-176380726 CCTTACATGCTGGAAGTATCTGG - Intergenic
918536940 1:185585003-185585025 CATTAGAGGCTGGAGCTGCATGG - Intergenic
924422951 1:243926162-243926184 CAATACCTGCTGGAGGTGGGGGG - Intergenic
924900916 1:248398194-248398216 CATTACATCCTAGAGGTGGGAGG + Intergenic
1066320322 10:34296696-34296718 CAGTACATGCTGATGGTGGATGG + Intronic
1067758597 10:49025932-49025954 CATTTCATGCTGGGGATGTAAGG + Intronic
1070730942 10:78827964-78827986 CATCACAGGCTGGAGGTGGAGGG - Intergenic
1070883069 10:79866161-79866183 CATTTCCTGGTGGAGGTGGAAGG - Intergenic
1071350339 10:84734317-84734339 CATTATATTCTGGAAGTTTAAGG + Intergenic
1074860780 10:117508634-117508656 AATTCCATGCTGGAGGAGTTTGG + Intergenic
1076057530 10:127387718-127387740 CATTACATTATGGACGTGTGTGG + Intronic
1080514865 11:33010942-33010964 CATTACATGATGGATGTATTTGG - Intergenic
1080610672 11:33901095-33901117 CATTTCATGGTGGTGGTGTAAGG + Intergenic
1081245747 11:40764325-40764347 CAGTACTTGCTGTAGGTCTAGGG + Intronic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1084725428 11:70938800-70938822 CATTCCATGCTCTAGGTGTGTGG - Intronic
1085122224 11:73974539-73974561 GATTGGATGCTGGAGGTGGAAGG + Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1094743016 12:33310828-33310850 CATTACTGGCTGGAGGTCTCTGG + Intergenic
1097504001 12:60441241-60441263 CCTTACATGCTGGAGGGGATTGG + Intergenic
1104601245 12:130154941-130154963 CATGACATGCGTGAGCTGTAAGG + Intergenic
1108185433 13:47884127-47884149 GAATAAATGCTGAAGGTGTATGG - Intergenic
1108528162 13:51303408-51303430 CTTAACACTCTGGAGGTGTAGGG - Intergenic
1112826314 13:103396735-103396757 CCTTACATGATGGAGGGGTGAGG + Intergenic
1119078108 14:71664836-71664858 CATTACAGGCTGAAGTTATATGG + Intronic
1120055928 14:79924042-79924064 CCTTACATGATGGAGGGGTAAGG + Intergenic
1121714754 14:96065652-96065674 TACTACATGCTGGGGGTGGAGGG - Intronic
1126706546 15:51411219-51411241 CTTTATAAGCTGGAGGTGTAAGG - Intergenic
1129062056 15:72868034-72868056 CATTCCTTGCTGGAGGTTCAAGG + Intergenic
1131864680 15:96694913-96694935 CATAACATGCTGAAGGTTCACGG + Intergenic
1133655321 16:7856641-7856663 CATTGCATGTTGGAGCTGTGTGG - Intergenic
1134293931 16:12927847-12927869 CATCACATTTTGGAGGTGGAGGG + Intronic
1134559699 16:15197773-15197795 CATTAGAAGCTGGAGCTGTAAGG + Intergenic
1134920238 16:18109384-18109406 CATTAGAAGCTGGAGCTGTAAGG + Intergenic
1135083837 16:19458809-19458831 AATGACATACTTGAGGTGTAAGG - Intronic
1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG + Intronic
1138945383 16:61843009-61843031 CAGGACCTGCTGGAGGTGGATGG + Intronic
1139468661 16:67166966-67166988 AGTCACATGCTGGAGGTGGAAGG - Intronic
1139941600 16:70609662-70609684 GACTACAGCCTGGAGGTGTATGG + Intronic
1141823411 16:86463153-86463175 CAGTACATGCTGGTGGGTTAGGG + Intergenic
1142037076 16:87869049-87869071 GCCTACATGCTGGAGGTCTACGG - Exonic
1145961488 17:28888812-28888834 CATTCCATTCTGGCGGTGGAGGG - Intronic
1148985295 17:51615618-51615640 CATTGCATGCTGCTGGTGGAAGG + Intergenic
1149536281 17:57436006-57436028 ACTTCCATGCTGGAGGTGGAGGG + Intronic
1150138809 17:62711741-62711763 CAGTACAAGCTGGATGTGTCGGG + Intronic
1150664590 17:67120811-67120833 CATTACATACTAAAGGTGCAGGG - Intronic
1156105898 18:33660240-33660262 GATCACATGTTGGAAGTGTATGG + Intronic
928327677 2:30333111-30333133 CATTTCCTGCTGGAGGAGGAGGG + Intergenic
930889362 2:56365034-56365056 CATGACATGCAGGAGTTGCATGG - Intronic
933107135 2:78344748-78344770 GATCACATGCTGTAGGTGTGTGG + Intergenic
934046510 2:88177128-88177150 CATTAAATGCTGGACCTGAAGGG + Intronic
936833173 2:116674071-116674093 TATTATATTCTGTAGGTGTATGG + Intergenic
939496095 2:142930239-142930261 CACTACCTTCTGGAGGTGTGAGG - Intronic
941379400 2:164775027-164775049 CAGTACATGCTGTAGTTCTATGG + Intronic
942015042 2:171805028-171805050 CATTAAATGGGGGAGTTGTATGG + Intronic
946929646 2:224659179-224659201 CTTTACATGGAGGAGTTGTATGG - Intergenic
947621422 2:231593656-231593678 CACTGCCTGCTGGAGGTGGAGGG - Exonic
948395776 2:237643959-237643981 TATTACATGAAGGAGGGGTAAGG - Intronic
1169761300 20:9097669-9097691 AATTAAAAGCTGGAGGTGAATGG - Intronic
1172988906 20:39017363-39017385 CATTACATGCTTGAGAAGAAGGG - Intronic
1182548116 22:31087143-31087165 CTCTACATGGTGGAGGTGTGGGG + Intronic
1183392922 22:37556108-37556130 CATTACAGGATGGAAGTGGAAGG + Intergenic
1184494106 22:44827292-44827314 CACCACATCCTGGAGGTGTCAGG - Intronic
1184765475 22:46569914-46569936 CTTTTCATGCTGGTGGTGTCAGG + Intergenic
950320460 3:12047811-12047833 CATTAGTTGTTGGAGTTGTAAGG + Intronic
950910271 3:16582344-16582366 CATAAAATGCTGGAGGTGGCAGG - Intergenic
951693480 3:25421248-25421270 CATTTCAGGCTGCAGGTGGAGGG - Intronic
951731759 3:25817166-25817188 CATTACTTGATGGAAGTGTCAGG + Intergenic
953017524 3:39092471-39092493 CATCCCATGCTGCAGGTGCATGG - Intronic
959324535 3:104920102-104920124 GATTACATGTTTGAGGTTTAGGG + Intergenic
961063511 3:123853588-123853610 CACTATATGATGGAGGTGTAGGG + Intronic
963400914 3:144797970-144797992 AATTACATGTTGCAGGTGTTTGG + Intergenic
970966485 4:21934359-21934381 CATTAAATGCTTGAGGGGTTTGG - Intronic
976639192 4:87319698-87319720 CATTACATTCTTCAGGTGTTTGG + Intronic
979926578 4:126574068-126574090 CAACCCATGCTGGAGGGGTAAGG - Intergenic
980266067 4:130517531-130517553 CATTGCATGGTGGAGGTCAAAGG - Intergenic
981998293 4:150998987-150999009 CATTATCTGCTGGAAGTCTAAGG - Intronic
982388569 4:154839025-154839047 CATTAGAGGCTGGAGCTGCATGG - Intergenic
989005053 5:36800921-36800943 ATTTACATGCAGGAGGTTTATGG - Intergenic
990289406 5:54333428-54333450 CATGACATGCTGTATGTTTATGG - Intergenic
990496598 5:56354199-56354221 CATGACCTCCTGGAGGTGCAGGG - Intergenic
993515233 5:88824778-88824800 CATTACATACTGGAGATCTCTGG + Intronic
993548494 5:89243822-89243844 CATTACTTGAGAGAGGTGTAGGG + Intergenic
995661719 5:114491248-114491270 CATTACTTGCTGGAGGCATCTGG + Intronic
996057491 5:118997985-118998007 CTTTACATGCAAGATGTGTAAGG - Intergenic
1006705052 6:36012725-36012747 GATTACATGCTGGACGTATATGG - Intronic
1008770395 6:54971728-54971750 CATTACATGATGGAGGTCTCAGG + Intergenic
1013607279 6:111761957-111761979 CATTACATCATGGAGGAGTGTGG + Intronic
1014191129 6:118498054-118498076 CATTACCTTCAGGTGGTGTAGGG + Intronic
1015216446 6:130755589-130755611 CATGAGATGCTGGAGAGGTATGG - Intergenic
1015902595 6:138083191-138083213 CATTACCTCCTGCAGCTGTAGGG + Intergenic
1016450008 6:144172822-144172844 CATTATATGTTGGATGTGTATGG - Intronic
1019068648 6:169323554-169323576 CATTACATGATGAAGGGGTAAGG - Intergenic
1026480983 7:70779482-70779504 CATTTCCAGCTGGAGGTGCACGG + Intronic
1034731872 7:153394179-153394201 TTTTACATGCAGGATGTGTAAGG + Intergenic
1037503869 8:19511449-19511471 CATACCATCCTGGAGGTGTGTGG + Intronic
1046045153 8:108955396-108955418 CACTACTCTCTGGAGGTGTATGG - Intergenic
1046406018 8:113773690-113773712 CATTACTTGCTGAAGCTGAAGGG - Intergenic
1048008106 8:130435434-130435456 CAGTGCCTGCTGGAGGTGCAAGG - Intronic
1048785123 8:138042251-138042273 CAATATCTGCTGAAGGTGTAAGG - Intergenic
1050347062 9:4700868-4700890 CATTGCATGCTTAAGGTTTAGGG - Intronic
1056641004 9:88370500-88370522 TATTACATGCTGGTGATTTATGG + Intergenic
1058622314 9:106896516-106896538 CATTACCTTCTGGAGCTATATGG - Intronic
1187252557 X:17612044-17612066 AATAACATGCTGGGGGTGTAGGG - Intronic
1187399178 X:18944459-18944481 CATTACATTCTGGAGGAGGGAGG + Intronic
1191634734 X:63363393-63363415 CATTAGAGGCTGGAGCTGTATGG - Intergenic
1191852370 X:65594953-65594975 CATTACATGCTGGAGGTGTAGGG - Intronic
1195159424 X:102156296-102156318 CTTTACTTGCTGGACGTGAAGGG - Intergenic
1195591192 X:106629008-106629030 TATTATTTGCTGGATGTGTATGG + Intronic
1196767949 X:119266305-119266327 CATTCCTGGCTGGAGGTGTCTGG - Intergenic
1197870389 X:131058236-131058258 CGTGACATGCTCGAGGTGTCCGG + Exonic
1201860033 Y:18586783-18586805 CTTTCCTTGCTGGAGGTGCAGGG - Intronic
1201873288 Y:18733598-18733620 CTTTCCTTGCTGGAGGTGCAGGG + Intronic
1202276372 Y:23124879-23124901 CATGAAATGCTGGAGGTGGCAGG - Intergenic
1202289656 Y:23295811-23295833 CATGAAATGCTGGAGGTGGCAGG + Intergenic
1202429366 Y:24758604-24758626 CATGAAATGCTGGAGGTGGCAGG - Intergenic
1202441425 Y:24911486-24911508 CATGAAATGCTGGAGGTGGCAGG + Intergenic