ID: 1191864858

View in Genome Browser
Species Human (GRCh38)
Location X:65695751-65695773
Sequence GTGCCAGCTCATAGATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191864858_1191864863 -5 Left 1191864858 X:65695751-65695773 CCCCCAAATCTATGAGCTGGCAC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1191864863 X:65695769-65695791 GGCACCTAATGCCAAAGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 95
1191864858_1191864862 -8 Left 1191864858 X:65695751-65695773 CCCCCAAATCTATGAGCTGGCAC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1191864862 X:65695766-65695788 GCTGGCACCTAATGCCAAAGTGG 0: 1
1: 0
2: 1
3: 4
4: 95
1191864858_1191864864 -4 Left 1191864858 X:65695751-65695773 CCCCCAAATCTATGAGCTGGCAC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1191864864 X:65695770-65695792 GCACCTAATGCCAAAGTGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191864858 Original CRISPR GTGCCAGCTCATAGATTTGG GGG (reversed) Intronic
903957988 1:27038302-27038324 GTGGCAGATCATAGTCTTGGTGG + Intergenic
906256794 1:44356469-44356491 GTTCCAGCTCCAAGAGTTGGGGG - Intergenic
907708662 1:56855423-56855445 GTGCTGTCTCATAGTTTTGGGGG + Intronic
910100844 1:83574508-83574530 GTGGCATCCAATAGATTTGGAGG - Intergenic
915907773 1:159891447-159891469 CTGCCAGCTCATTGAGTTGGTGG + Intronic
917098390 1:171422544-171422566 GTGCCAGCAGATCCATTTGGTGG - Intergenic
918333192 1:183480052-183480074 GTGGTAGTTCAAAGATTTGGTGG + Intronic
924421301 1:243912581-243912603 ATGCCAGTTTATAGATTTGGTGG + Intergenic
1063058430 10:2526354-2526376 GTTCCAACACATGGATTTGGGGG - Intergenic
1063723392 10:8609296-8609318 GTTTCAGCACATAAATTTGGTGG + Intergenic
1069274118 10:66567787-66567809 ATGCCAGCTCAGAGATGAGGAGG - Intronic
1069845160 10:71365809-71365831 GAACCAGCTCATATGTTTGGAGG + Intergenic
1070235043 10:74615512-74615534 GTGCCGTCTCATAAAATTGGGGG - Intronic
1072349526 10:94543799-94543821 GTGCCAGCACATGTGTTTGGTGG + Intronic
1077518839 11:3019147-3019169 GTGCCAGCTCATTGTCATGGTGG + Exonic
1081500777 11:43664471-43664493 GTGCCAGCCGATCCATTTGGTGG + Intronic
1082949007 11:58790284-58790306 GTGCCATGTCTTAGATTTTGAGG + Intergenic
1084753991 11:71223055-71223077 GAGGGAGCTCAGAGATTTGGAGG + Intronic
1086300630 11:85423355-85423377 GTGACAGTTCTTAGCTTTGGTGG + Intronic
1088835053 11:113570743-113570765 GTGTAAGCTCTTAGCTTTGGTGG - Intergenic
1090722807 11:129492155-129492177 GTGCTAGCTCAAACAGTTGGGGG + Intergenic
1092853794 12:12654285-12654307 GTCCCAGCTATTACATTTGGAGG + Intergenic
1101698701 12:107151600-107151622 GTGCCAGCGGATCCATTTGGTGG + Intergenic
1103024420 12:117562129-117562151 GTTCCAGCACAAAGGTTTGGAGG + Intronic
1103183540 12:118936123-118936145 GTGCCAGATTATAGTTGTGGGGG + Intergenic
1105261215 13:18780751-18780773 ATGCAAGCTCATAGACTTGGTGG - Intergenic
1106717705 13:32408208-32408230 GGGCCAGCTCAGAGTTTAGGGGG - Intronic
1107709051 13:43134546-43134568 GTGCCAGCAGATACATTTGGTGG + Intergenic
1112826604 13:103398813-103398835 GTGCCAGCCCCAAGCTTTGGTGG - Intergenic
1117103720 14:52377925-52377947 GTACCAGCTCATAGCTCTGCTGG - Intergenic
1119121705 14:72085462-72085484 GTCCCAGCCCAGAGATTTGTTGG + Intronic
1121439542 14:93940072-93940094 TTGCCAGCTCAGTTATTTGGAGG + Intronic
1122823655 14:104359387-104359409 GTGCCTCCTCAGAGATTTTGGGG + Intergenic
1124075396 15:26439061-26439083 GTCCCAGCTAATAGATTTGCTGG - Intergenic
1129107997 15:73322473-73322495 GGCCCAGCTCATAGATTGGATGG + Exonic
1129926136 15:79365880-79365902 GTGCCAGCAGATCCATTTGGTGG + Intronic
1130155229 15:81344690-81344712 GTGACAGCTCAGAGAGTTGCTGG + Intronic
1131481198 15:92783190-92783212 GTGCCAGCGGATCCATTTGGTGG - Intronic
1132320719 15:100923108-100923130 GTACCAGCGCACAGACTTGGAGG - Intronic
1133131879 16:3681174-3681196 GTCCCAATTCATAGATGTGGAGG - Intronic
1133620303 16:7519839-7519861 TTGCCACCTCATTCATTTGGAGG + Intronic
1136459696 16:30402050-30402072 TTTCCAGCTCATAGGTTTGCTGG - Intergenic
1137365066 16:47853259-47853281 GTGCCAGCGGATCCATTTGGTGG + Intergenic
1138091877 16:54181521-54181543 CTGCAAGATCAAAGATTTGGTGG - Intergenic
1143148790 17:4794212-4794234 GTGCCAGCTCTTACATTTTTAGG - Intergenic
1146787627 17:35732736-35732758 GTGGCAGCTCAGAGATTTCTAGG - Intronic
1151554362 17:74839161-74839183 CTGCCAGCTTATAGATGGGGCGG + Exonic
1152507001 17:80756069-80756091 TTTCCAGCACATACATTTGGGGG - Intronic
1153008442 18:516332-516354 GTGCCAGCAGATCCATTTGGTGG - Intergenic
1154424812 18:14264057-14264079 ATGCAAGCTCATAGACGTGGTGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1168311846 19:55464604-55464626 CTCCCTGCTCACAGATTTGGGGG - Intergenic
926728618 2:16017751-16017773 CTGACAGCCCATAGCTTTGGTGG - Intergenic
933262072 2:80141943-80141965 GTGCCAGCGGATCCATTTGGTGG - Intronic
933811637 2:86036348-86036370 GTGCCAGTGCAGAGATCTGGGGG + Intronic
938629071 2:133145560-133145582 AGGCCAGCTCATATATTGGGAGG - Intronic
939534443 2:143409619-143409641 ATGACAGCTCATATATGTGGTGG + Intronic
940266878 2:151848173-151848195 GTGCTAGATCATAGCATTGGTGG + Intronic
942275085 2:174315447-174315469 GTTCCAGCACATAAATTTGAGGG + Intergenic
1169800878 20:9510062-9510084 GTGCCATCTCAGAGATTTTGAGG + Intergenic
1170819428 20:19743816-19743838 GGGCCAGTTGTTAGATTTGGTGG - Intergenic
1172168171 20:32911611-32911633 GTGCCTGCTCACAGGTTTGCGGG + Intronic
1175469114 20:59213648-59213670 GTTCATGCTCAAAGATTTGGGGG - Intronic
1176847271 21:13886032-13886054 ATGCAAGCTCATAGACTTGGTGG - Intergenic
1176983545 21:15410168-15410190 GTGCCCTTTCATAGGTTTGGGGG - Intergenic
1177532111 21:22373923-22373945 GTGCAAGCCCCAAGATTTGGTGG - Intergenic
1178242471 21:30918449-30918471 TTTCCAGCACATAGCTTTGGGGG + Intergenic
1179077657 21:38138806-38138828 TTGGCAGCTAATAGATCTGGAGG + Intronic
1181992651 22:26849281-26849303 GTGCCAGGGCATAGATGGGGCGG - Intergenic
1183239535 22:36646988-36647010 CTGCCAGCTCACAGCTCTGGAGG + Intronic
949823457 3:8139753-8139775 GTGCCAGCAGATCCATTTGGTGG + Intergenic
951430144 3:22597230-22597252 GTGCACGCTCCAAGATTTGGTGG + Intergenic
952908593 3:38163869-38163891 GTGCCAGCAGATCCATTTGGTGG + Intergenic
956353415 3:68363967-68363989 TTTCCAGCTGATGGATTTGGTGG + Intronic
956992959 3:74790033-74790055 GTGCCATCTCAAAGATTTTTAGG + Intergenic
962833406 3:139163975-139163997 ATTCCAGCTCATAAATGTGGAGG - Intronic
966243281 3:177778089-177778111 GTACCAGCTTATACCTTTGGTGG + Intergenic
967080428 3:186044625-186044647 GAGCCAGCTCTTAAAGTTGGAGG + Intergenic
971139226 4:23905543-23905565 TTCACAGTTCATAGATTTGGTGG + Intergenic
972166661 4:36293729-36293751 GTTCCTGCTCATAGATTTTGTGG + Intronic
973613990 4:52660845-52660867 GTACCAGCTGATAGTTATGGTGG - Intergenic
973961863 4:56118403-56118425 GTTCCTTCTCATAGATTTGTAGG - Intergenic
977471363 4:97447612-97447634 GTGCAAGCTCCAAGATTTGGTGG + Intronic
978840862 4:113209970-113209992 GTGCCAGCAGATCTATTTGGTGG + Intronic
982930999 4:161407575-161407597 TTGCCAGCTCATAGGTCTGTGGG - Intronic
985932467 5:3069218-3069240 TTGCCAGCTCAGAGAGTCGGTGG - Intergenic
986089522 5:4490064-4490086 GTGCCTGCTGACAGATTTAGCGG - Intergenic
988663286 5:33297398-33297420 GTGCCAGCAGATCCATTTGGTGG - Intergenic
989340397 5:40367769-40367791 TTGCCAACACATAAATTTGGGGG + Intergenic
990866247 5:60383617-60383639 GTCCCAGTTCAGAGAGTTGGCGG + Intronic
999486727 5:152004383-152004405 GAGCGAGCTCATGGATTGGGAGG + Intergenic
1001529541 5:172452680-172452702 TTGCCAGCTCACAGACCTGGTGG + Intronic
1007301357 6:40870301-40870323 GTGCCAGCAGATCCATTTGGTGG + Intergenic
1009969923 6:70615333-70615355 GTGACATCTCATAGTTCTGGAGG + Intergenic
1012215511 6:96578039-96578061 CTCCCAGCTTTTAGATTTGGTGG + Intronic
1013183566 6:107738225-107738247 ATGTCAGCTAATAGAATTGGAGG + Intronic
1014980311 6:127938242-127938264 GTACCAGCTCTGAGATCTGGGGG + Intergenic
1022561200 7:31351701-31351723 GAGGCAGCACATATATTTGGTGG + Intergenic
1023110705 7:36808064-36808086 GTGCCAGCAGATTCATTTGGTGG + Intergenic
1028280958 7:88927009-88927031 GTGGCAGCGCATACATTTTGGGG + Intronic
1029530768 7:101123761-101123783 GTCCCCACTCATAGATTGGGTGG - Intergenic
1033486336 7:141792534-141792556 GTGCCAGGTCTTTGAGTTGGAGG + Intergenic
1034607696 7:152332465-152332487 ATGCCATCTCATGAATTTGGTGG - Intronic
1036488578 8:9202404-9202426 GTGCCAGCGGATTCATTTGGTGG - Intergenic
1038043191 8:23744083-23744105 GTGAAACCTCATAGATTTGTAGG - Intergenic
1040869319 8:52083938-52083960 GTGGCTGCTCACAGATTTGCAGG + Intergenic
1043926890 8:86046957-86046979 GTGCCACCTCATGGCCTTGGGGG - Intronic
1045904860 8:107332674-107332696 GGGCCAGCTCACTGACTTGGCGG + Intronic
1049249921 8:141582818-141582840 GTGCCAGCTCACAGAGAAGGGGG - Intergenic
1053415377 9:37944069-37944091 GTGCCAGGTCAATGAGTTGGCGG + Intronic
1056421741 9:86434847-86434869 CTACCAGCTCATAGCTTAGGTGG + Intergenic
1057702343 9:97372740-97372762 GTTCCAGCTCCTAGAGGTGGAGG + Intronic
1058357740 9:104104185-104104207 AAGCCTGCTTATAGATTTGGAGG - Intronic
1059145830 9:111897824-111897846 ATGCCAGCTCGGAGGTTTGGTGG - Intronic
1059420921 9:114191850-114191872 TTGCCAACTTATGGATTTGGAGG + Intronic
1185867090 X:3633747-3633769 GTGTCAGCTGATAGTTTAGGAGG - Intronic
1187112377 X:16314938-16314960 GTGCCAGCAGATCTATTTGGTGG - Intergenic
1189886074 X:45546063-45546085 GTGCAAGCTCTAAGCTTTGGTGG + Intergenic
1190249443 X:48711005-48711027 GTGCCAGCTCAGTTGTTTGGGGG - Intergenic
1191864858 X:65695751-65695773 GTGCCAGCTCATAGATTTGGGGG - Intronic
1191954175 X:66625730-66625752 GTGACAGTTCTTAGCTTTGGTGG - Intronic
1192203999 X:69084183-69084205 GTGCCAGCTCCCAGCTCTGGAGG + Intergenic
1193553341 X:82925835-82925857 GTTTCAACACATAGATTTGGGGG + Intergenic
1200796876 Y:7348933-7348955 GTGTCAGCTGATAGTTTAGGAGG + Intergenic
1200954470 Y:8930137-8930159 GTGCCAGGTCAAAGGTCTGGGGG - Intergenic