ID: 1191865244

View in Genome Browser
Species Human (GRCh38)
Location X:65698568-65698590
Sequence CAGCAGAAGCAGTGGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 537}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191865244_1191865257 5 Left 1191865244 X:65698568-65698590 CCTGCCCCCCACTGCTTCTGCTG 0: 1
1: 0
2: 4
3: 63
4: 537
Right 1191865257 X:65698596-65698618 CTGTGGTGATGTTCTGCCTGGGG 0: 2
1: 1
2: 0
3: 28
4: 180
1191865244_1191865258 8 Left 1191865244 X:65698568-65698590 CCTGCCCCCCACTGCTTCTGCTG 0: 1
1: 0
2: 4
3: 63
4: 537
Right 1191865258 X:65698599-65698621 TGGTGATGTTCTGCCTGGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 244
1191865244_1191865254 3 Left 1191865244 X:65698568-65698590 CCTGCCCCCCACTGCTTCTGCTG 0: 1
1: 0
2: 4
3: 63
4: 537
Right 1191865254 X:65698594-65698616 ACCTGTGGTGATGTTCTGCCTGG 0: 1
1: 1
2: 1
3: 13
4: 123
1191865244_1191865260 10 Left 1191865244 X:65698568-65698590 CCTGCCCCCCACTGCTTCTGCTG 0: 1
1: 0
2: 4
3: 63
4: 537
Right 1191865260 X:65698601-65698623 GTGATGTTCTGCCTGGGGTGGGG 0: 1
1: 0
2: 0
3: 28
4: 289
1191865244_1191865259 9 Left 1191865244 X:65698568-65698590 CCTGCCCCCCACTGCTTCTGCTG 0: 1
1: 0
2: 4
3: 63
4: 537
Right 1191865259 X:65698600-65698622 GGTGATGTTCTGCCTGGGGTGGG 0: 1
1: 0
2: 0
3: 43
4: 283
1191865244_1191865256 4 Left 1191865244 X:65698568-65698590 CCTGCCCCCCACTGCTTCTGCTG 0: 1
1: 0
2: 4
3: 63
4: 537
Right 1191865256 X:65698595-65698617 CCTGTGGTGATGTTCTGCCTGGG 0: 2
1: 0
2: 2
3: 21
4: 247
1191865244_1191865261 18 Left 1191865244 X:65698568-65698590 CCTGCCCCCCACTGCTTCTGCTG 0: 1
1: 0
2: 4
3: 63
4: 537
Right 1191865261 X:65698609-65698631 CTGCCTGGGGTGGGGAAAAGAGG 0: 1
1: 0
2: 9
3: 108
4: 690

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191865244 Original CRISPR CAGCAGAAGCAGTGGGGGGC AGG (reversed) Intronic
900597589 1:3489576-3489598 GAGCATCAGCAGTGGGGGGAGGG - Intergenic
901004600 1:6165725-6165747 CAGCAGCAGAAGAGGAGGGCGGG + Intronic
901146784 1:7070186-7070208 CAGCAGCATCAGATGGGGGCGGG + Intronic
901497880 1:9632484-9632506 CAGCAGAAACAGAGGGCAGCTGG - Intergenic
902081016 1:13820735-13820757 CAGCAGCAGGAGCTGGGGGCTGG - Intronic
902268752 1:15288126-15288148 CAGCACAGGCAGTGGTGGACAGG - Intronic
902558955 1:17265057-17265079 AAGAAGAAGCAGTGAGGGGCAGG - Intronic
902909027 1:19581446-19581468 GAAAAGAAGCAGTGGAGGGCTGG - Intergenic
902934629 1:19755948-19755970 CAGCAAAAGCAAGGTGGGGCTGG + Intronic
903007913 1:20310637-20310659 CATCAGACGCGGTGAGGGGCAGG - Exonic
903019444 1:20383731-20383753 CAGCAGAAGCAGTGGTGTAGAGG + Intergenic
903394106 1:22986075-22986097 CAGAAGAAGCAGGGGAGGGATGG + Intergenic
903559227 1:24215511-24215533 AAGCAGAAGGAGAGGAGGGCAGG + Intergenic
903843628 1:26263030-26263052 AAGCAGCAGCAGTGAGGGCCAGG - Intronic
904899869 1:33848412-33848434 CAGGAGAATCAGTGGGAGACTGG - Intronic
905289286 1:36910556-36910578 CAGCAGCAGTGGTGGGGGGGCGG + Intronic
905488486 1:38324941-38324963 CAACAGAACCAGTAGGTGGCAGG - Intergenic
905723599 1:40228904-40228926 AGGCAGAGGCAGCGGGGGGCGGG - Intronic
906262523 1:44405367-44405389 CAGCAGCAGCAGTAGGCGGCTGG - Exonic
907185752 1:52607883-52607905 CATCAGAATCACTGGGGGTCAGG - Intronic
907246741 1:53113816-53113838 CAGCAGAAGGGGTGAGAGGCAGG - Intronic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907419326 1:54336351-54336373 GAGGAGAGGCAGTCGGGGGCTGG - Intronic
908286283 1:62607221-62607243 TAGCAGTAGCAGTAAGGGGCTGG - Intronic
910698273 1:90045236-90045258 TAGAAGAATCAGTGGGTGGCAGG + Intergenic
911049187 1:93655098-93655120 CAGCAGGAACAGTAAGGGGCTGG + Intronic
911288537 1:96027929-96027951 CTGCAGGAACAGTGTGGGGCAGG - Intergenic
912794949 1:112687618-112687640 CAGGAGGAGCAGAGGTGGGCAGG - Intronic
913233453 1:116761066-116761088 CTGCAGAAACCCTGGGGGGCAGG + Intronic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
915119411 1:153619363-153619385 CAGCAGCTGCAGTGGTGTGCTGG - Intronic
915170313 1:153972905-153972927 CAGGAGAAGCATTGGGGAGTTGG + Intronic
916210523 1:162356413-162356435 CACCAGAGGCAGTGGAGGGCAGG + Intronic
916720475 1:167481748-167481770 CAGGAAAAGCAGTGGTGGGGTGG + Intronic
916797512 1:168180328-168180350 GAGGAGAAGCAGATGGGGGCAGG + Intronic
916844518 1:168635699-168635721 CAGCACCAGCAGTGGGAAGCAGG + Intergenic
916966188 1:169945127-169945149 GGGCTGAGGCAGTGGGGGGCGGG + Intronic
917267929 1:173241720-173241742 CAGCAGAGGCTATGGGAGGCAGG + Intergenic
918045668 1:180939546-180939568 CAGGAGAAGTGGTGGGAGGCAGG - Intronic
919109012 1:193193182-193193204 CAGCCTAAGAAGTTGGGGGCAGG - Intronic
919805802 1:201380451-201380473 CAGCACTAGCAGTGGGTGGGAGG + Intronic
920111436 1:203590065-203590087 AAAGAGAAGCGGTGGGGGGCTGG - Intergenic
920285162 1:204873880-204873902 CAGGAGCTGCAGTGGGGAGCAGG + Intronic
920426357 1:205879680-205879702 CAGTAGAGACAGTGGTGGGCTGG + Intergenic
921017600 1:211206861-211206883 TATCAGAAGCTGTGGGGGCCAGG + Intergenic
921800633 1:219399044-219399066 CAGCAGTAGCAGTGCAGGGAGGG + Intergenic
922076856 1:222253666-222253688 CAGCAGAAGCAGTTGGACGTTGG + Intergenic
922424568 1:225481032-225481054 CAGCAGGGGCTGTGGGAGGCAGG - Intergenic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
922914014 1:229240861-229240883 AACCAGAAGCAGAGGGGGCCCGG + Intergenic
923503462 1:234585539-234585561 GAGCAAAAGCAGAGGGTGGCAGG - Intergenic
923552972 1:234978914-234978936 AAGCAGAGGCAGCAGGGGGCAGG + Intergenic
924800072 1:247322945-247322967 CAGTAGACCCAGTGGGCGGCTGG + Intronic
1062860428 10:805700-805722 CTGCAGAAGCAGCCGGGGACAGG + Intergenic
1065244450 10:23743063-23743085 CCACTGAAGCAGTGTGGGGCAGG + Intronic
1066517964 10:36184943-36184965 CAGAAGGACCACTGGGGGGCTGG + Intergenic
1067229275 10:44395527-44395549 CAGCAGGAGCAGCTGAGGGCAGG + Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067560354 10:47300686-47300708 CAGCAGCAGCAGCTGGGGCCCGG - Exonic
1068832148 10:61507589-61507611 CAGAAGAGGTAGTGGGAGGCAGG + Intergenic
1069069023 10:63975197-63975219 CTGCAGAAGCAGTGATAGGCTGG - Intergenic
1069622520 10:69846559-69846581 GAGCAGAAGAAGGGGAGGGCAGG - Intronic
1070804475 10:79262989-79263011 CAGCAGAAGCAGCTGACGGCTGG - Intronic
1070815201 10:79318486-79318508 CAGCAGGGACAGTGGGGAGCTGG - Intergenic
1071490355 10:86132005-86132027 CAGCACAAGCAGTGGGTGCAGGG + Intronic
1072098240 10:92203998-92204020 CATCAGAAGCAGTGGGAGACAGG - Intronic
1072803806 10:98411317-98411339 CAGGAGAAGCAATGGGTGGCTGG + Intronic
1072954255 10:99874884-99874906 CAGCTCAGGCAGTTGGGGGCAGG - Intergenic
1073330798 10:102668829-102668851 CAGCAGCTGCAGGGTGGGGCGGG + Intergenic
1073578594 10:104644037-104644059 CAGCAGAAGAGGTGAGGGGCAGG + Intronic
1074906811 10:117871426-117871448 CAGCAGAAACAACGGGGGGTGGG - Intergenic
1075330100 10:121567657-121567679 CAGCAGTGGCAGAGGAGGGCTGG + Intronic
1075453662 10:122570656-122570678 CAGCAGAAGAGGTTGGGGGAGGG + Intronic
1075453862 10:122572080-122572102 CAGCAGAAGAGGTTGGGGGAGGG + Intronic
1075475063 10:122727427-122727449 CAGCTGCAGCAGAGGGGGCCTGG - Intergenic
1076225383 10:128770579-128770601 CAGCAGAGACAGTGGAGAGCTGG + Intergenic
1076331794 10:129675704-129675726 CAGCAGCAGCAGTGGGTGTGTGG - Intronic
1076821424 10:132941891-132941913 CAGCGGATGCAGAGTGGGGCTGG - Intronic
1076866997 10:133172127-133172149 GAACAGAAGCAGTGTGAGGCTGG + Intronic
1076882107 10:133244755-133244777 CTGCAGAGGCAATGGGGGGAGGG - Intergenic
1076946643 10:133656280-133656302 CAGCACAGGCAGCGGGGGACAGG + Intergenic
1076983990 11:222514-222536 CAGCAGAGGCTGAGGGGTGCTGG - Intronic
1077063350 11:627114-627136 CAGCAGCAGCAGGAGGGGCCGGG + Exonic
1077192099 11:1259847-1259869 CAGCAGAGGCATGTGGGGGCAGG + Intronic
1077206738 11:1348429-1348451 CTGCTTAAGCAGTGGGTGGCTGG - Intergenic
1077214122 11:1388296-1388318 CAGCAGCAGCAGCGGGGGAAAGG + Intergenic
1077242210 11:1516582-1516604 CCGCTGATGGAGTGGGGGGCAGG + Intergenic
1077386774 11:2272983-2273005 CAGCAGACGCAGGTGGGTGCAGG - Intergenic
1077483268 11:2826522-2826544 AAGCAGCAGCAGGAGGGGGCGGG - Intronic
1078912817 11:15749262-15749284 CATGAGAAGCAGTGTCGGGCAGG + Intergenic
1079128439 11:17734597-17734619 CAGCAGGAGCCGCGCGGGGCGGG + Intergenic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1079333176 11:19549974-19549996 CAGCAGAAGCCGGGGGAGGCTGG - Intronic
1080540205 11:33257678-33257700 CAGCAGCAGCGGTCGGGGGAGGG + Exonic
1082879211 11:58021834-58021856 CTAGAGAAGCAGTGGGAGGCAGG + Intergenic
1083592524 11:63904004-63904026 AAGCAGAAGCCGTGGAGGCCCGG - Exonic
1083594064 11:63910774-63910796 CCGCAGTAGGAGTGTGGGGCAGG - Exonic
1083644435 11:64164505-64164527 CAGCAGGAGGAGTTTGGGGCTGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084554482 11:69867823-69867845 CAGCTGGAGCAGTGGGGCCCGGG - Intergenic
1084575241 11:69984864-69984886 CAGGAGAGGCCGTGGGGGACAGG - Intergenic
1084699894 11:70779783-70779805 CAGCAGAAGGAGGGGGTGGCAGG - Intronic
1084944272 11:72630506-72630528 CAGCAGGAGCAGTTTGGGGGAGG + Intronic
1085282611 11:75340912-75340934 CAGCAGCAGCAGTGTGGTGCTGG - Intronic
1086026840 11:82303928-82303950 CAGGAGAAGCAGTGGATGGAAGG - Intergenic
1086949375 11:92876051-92876073 CATCAGAAGCACCTGGGGGCAGG - Intronic
1087952276 11:104237463-104237485 CAGGAGATGGAGTTGGGGGCAGG + Intergenic
1088172840 11:107017854-107017876 CGGCAGAAGCAGCCGGGGTCGGG + Exonic
1089182145 11:116590446-116590468 CAGCAGAAGCCTTGGGAGGGAGG - Intergenic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1090035053 11:123242044-123242066 CACCGGAAGGAGTGGGTGGCAGG + Intergenic
1090163293 11:124518068-124518090 AAGCAGAAGCAGAGGGTGTCTGG - Intergenic
1090290112 11:125535943-125535965 AAGCAGAAGCAGTGGTGGGGTGG - Intergenic
1090602462 11:128387298-128387320 CTGGAGAAGCAGTGGGTGACAGG - Intergenic
1090663084 11:128895492-128895514 CAGCAGAAGCCATGGGTGTCAGG + Intronic
1090666525 11:128918303-128918325 CAGCAGGAGAATTCGGGGGCAGG + Exonic
1091172657 11:133532185-133532207 CAGGAGAGGCAGTGGGGAGATGG - Intronic
1091394570 12:145983-146005 GAGCAGACGCAGTGGAGGGAAGG - Intronic
1091556029 12:1574279-1574301 CAGGAGAATCACTGGGGCGCTGG - Intronic
1091779932 12:3207435-3207457 CAGTAGAAGTGGTGGGGGGTTGG + Intronic
1091822810 12:3489341-3489363 AAGCAGAAGCAGTGTTGGGTGGG + Intronic
1092294996 12:7190227-7190249 CAGCAAAAGCACTGGGGTGGAGG + Intronic
1092502602 12:9064329-9064351 CAGCTGCAGCAGGGAGGGGCGGG + Intergenic
1092727030 12:11496935-11496957 CAGCAGAAGCAGTGGCCGCCAGG - Intronic
1092884843 12:12915941-12915963 CAGCCGCAGCAGTGGGAGGAGGG - Exonic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094332871 12:29315311-29315333 CAGCAGAAGCACTGAGGGGGAGG + Intronic
1094500409 12:31016216-31016238 CAGCAGAAGCAGTGGCCGCCAGG + Intergenic
1094693704 12:32795675-32795697 TAGAAGAAGCAGTGATGGGCTGG - Intronic
1095446660 12:42288786-42288808 CTGCAGAAGCCCTGGGGGACAGG - Intronic
1096004437 12:48157512-48157534 AAGCAGAAGCTGTCGGGGGCAGG + Exonic
1096214427 12:49791666-49791688 CCGCCGAAGCAGTGGGTGGTGGG + Exonic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096309251 12:50505476-50505498 GCGCAGAAGCAGTGTGGGCCCGG - Intronic
1096460280 12:51818464-51818486 CCTCAGAAGCAGTGGGCTGCCGG - Intergenic
1096630894 12:52926148-52926170 CAGGAGAGGTGGTGGGGGGCGGG - Intronic
1096653198 12:53072365-53072387 AAACAGAAGCAGTGGGGGGTGGG - Intronic
1098356603 12:69618253-69618275 AAGTACAAGCAGTGGGGGGCTGG - Intergenic
1098563927 12:71909730-71909752 CAGTGTAGGCAGTGGGGGGCAGG - Intronic
1098635538 12:72780046-72780068 GAGCCGAAGCAGGGTGGGGCAGG + Intergenic
1101931173 12:109015452-109015474 CAGCAGAAGGGGTGGGAGTCTGG + Intronic
1102221934 12:111200740-111200762 CAGCAGAATTGGTGGGGGGCAGG + Intronic
1102472661 12:113168265-113168287 CAGCCGAGGCAGAGGGGGCCCGG + Intronic
1102754582 12:115327072-115327094 CATCAGAAGCCGTGGGGGTAGGG - Intergenic
1103197587 12:119058678-119058700 CATCAGAAGAAGTGGGGAGGGGG - Intronic
1103292192 12:119855572-119855594 CAGCACAAGCAGTGAAGGGAAGG - Intronic
1103557734 12:121776170-121776192 CAGCAGAAGCAGAGTGGCCCCGG - Exonic
1104843188 12:131834355-131834377 CAACAGAGGCTGTGGCGGGCGGG - Intronic
1104989098 12:132615043-132615065 CAGCAGAAGCTCTCGGGGGCTGG + Intergenic
1105422248 13:20263625-20263647 GAGCAGGAGCAGTGGGGCTCAGG - Intergenic
1106068247 13:26380045-26380067 CAGCAGGAGCAGTGGGATGCAGG + Intronic
1108128784 13:47274365-47274387 CAGGAGAAGCTTTGGGGGGTTGG + Intergenic
1110295217 13:73856230-73856252 TAGCAGAAGCTGTGGCTGGCGGG - Intronic
1111928893 13:94493272-94493294 CAGCATAAGTCGTGGGGGGCAGG - Intergenic
1112515416 13:100049044-100049066 GAGCAGAAGCAAGGGGAGGCAGG + Intergenic
1113383076 13:109821266-109821288 GAGCAGATGCAGGGAGGGGCAGG - Intergenic
1113674617 13:112198758-112198780 TATGGGAAGCAGTGGGGGGCTGG - Intergenic
1113823511 13:113232263-113232285 CAGCAGTAATAGTGGTGGGCGGG - Intronic
1113823518 13:113232295-113232317 CAGCAGTAATAGTGGTGGGCGGG - Intronic
1114054314 14:18953287-18953309 AGGCAGACGCTGTGGGGGGCGGG - Intergenic
1114108240 14:19448645-19448667 AGGCAGATGCTGTGGGGGGCGGG + Intergenic
1114307498 14:21437194-21437216 CTGCAGTGGCTGTGGGGGGCCGG + Intronic
1114458577 14:22872610-22872632 CGGAAGAGGGAGTGGGGGGCGGG - Intronic
1114618811 14:24082595-24082617 CTGCAGCAGCAGCTGGGGGCTGG - Exonic
1115035544 14:28852354-28852376 CAGCAGAAGTATTGGAGGGAGGG + Intergenic
1115382309 14:32754833-32754855 CAGCAGAAACTTTGCGGGGCAGG - Intronic
1116032758 14:39592335-39592357 CAGCAGAACAGGTGCGGGGCTGG + Intergenic
1116441781 14:44962432-44962454 CAGCAGAAGCAGCGCGGAGGGGG - Exonic
1117518359 14:56525232-56525254 AAACAGAAACAGTGGGAGGCTGG + Intronic
1117609306 14:57465763-57465785 CAGCAGAGGCTGTGGTGTGCTGG - Intergenic
1117658109 14:57977273-57977295 CAGCAGATGAAGTGTGGTGCAGG + Intronic
1117770692 14:59131247-59131269 CATCAAAAGCAGTAGGTGGCAGG - Intergenic
1118323087 14:64764730-64764752 TGGCAGAAGCAGGCGGGGGCAGG + Intronic
1119296773 14:73539169-73539191 CAGCTGGAGCAATGGTGGGCGGG - Intronic
1119301003 14:73571088-73571110 CAGCTGGAGCAATGGTGGGCGGG - Intronic
1119411374 14:74433145-74433167 GAGGAGATGCTGTGGGGGGCTGG + Intergenic
1119766831 14:77195767-77195789 GAGCAGCAGCTGTGGGGAGCGGG - Intronic
1120692993 14:87614174-87614196 CAGCCGACACAGTAGGGGGCTGG - Intergenic
1121312007 14:92940434-92940456 GTGCAGAAGCGATGGGGGGCGGG + Exonic
1121689330 14:95864863-95864885 CAGCAGACCCAGTGGTGAGCTGG - Intergenic
1122129276 14:99595765-99595787 CAGCAGGGGCAGGGTGGGGCTGG - Intronic
1122208980 14:100162742-100162764 CAGCAGCAGGGGTGGGGTGCTGG + Intergenic
1122264363 14:100539753-100539775 CAGCAGCATGACTGGGGGGCTGG - Intronic
1123122243 14:105922043-105922065 CAGCAGAGGCTGTGTGGAGCTGG + Intronic
1123171153 14:106373925-106373947 CAGCTACAGCAGTGGGGCGCAGG - Intergenic
1202920732 14_KI270723v1_random:28834-28856 CAGCACAGGCAGCGGGGGACAGG + Intergenic
1202924186 14_KI270724v1_random:8747-8769 CAGCACAGGCAGCGGGGGACAGG - Intergenic
1123404906 15:20013608-20013630 CAGCAGAGGCTGTGTGGAGCTGG + Intergenic
1123509275 15:20979829-20979851 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123514237 15:21020256-21020278 CAGCAGAGGCTGTGTGGAGCTGG + Intergenic
1123566499 15:21553576-21553598 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123602760 15:21990862-21990884 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123663356 15:22586189-22586211 CAGCAGCAGGGGTTGGGGGCGGG - Intergenic
1124004560 15:25785579-25785601 AGGCAGAAGCAGTGAGTGGCAGG + Intronic
1124051284 15:26199343-26199365 CAGCAGAGGAAGGGGGAGGCAGG - Intergenic
1124480113 15:30071859-30071881 GAGCAGAAGTAGTGGGGGAATGG - Intergenic
1124566264 15:30816853-30816875 CAGCAGCAGGGGTTGGGGGCGGG + Intergenic
1125782293 15:42280502-42280524 CAGCAGAAGCAGTTGGCTCCAGG + Intronic
1126252686 15:46587824-46587846 CAGCAGTGACAGTGGTGGGCTGG + Intergenic
1126288466 15:47043951-47043973 CAAGAGAAGCATGGGGGGGCAGG + Intergenic
1126695937 15:51325387-51325409 GAGCAGAAAAAGTGGGTGGCAGG - Intronic
1127047517 15:55043004-55043026 CAGCAGTGGCAGTGGTGGGTGGG + Intergenic
1127508314 15:59615941-59615963 TAGGAGGAGCAGTTGGGGGCCGG + Intronic
1128796823 15:70472441-70472463 CAGTAGAGGAGGTGGGGGGCGGG - Intergenic
1129322217 15:74781833-74781855 CTGCAGAAGCGCTGGGGGCCGGG - Intergenic
1129651941 15:77497231-77497253 CAGCAGATGCTGTGGGAGGCTGG - Intergenic
1129712019 15:77825302-77825324 CAGCAGGAGCTGTGGGTGTCGGG + Intergenic
1130042537 15:80417506-80417528 GAGAAGAAGCAGAGGGGGGATGG - Intronic
1130258671 15:82337716-82337738 CTGCAGCAGCTGTGGAGGGCCGG - Intergenic
1130270014 15:82441368-82441390 CTGCAGCAGCTGTGGAGGGCCGG + Intergenic
1130360345 15:83179160-83179182 CACCAGGGGCAGTGGGAGGCAGG - Intronic
1130462347 15:84168681-84168703 CTGCAGCAGCTGTGGAGGGCCGG + Intergenic
1130473968 15:84247603-84247625 CTGCAGCAGCTGTGGAGGGCCGG + Intergenic
1130481380 15:84361671-84361693 CTGCAGCAGCTGTGGAGGGCCGG + Intergenic
1130490325 15:84426104-84426126 CTGCAGCAGCTGTGGAGGGCCGG - Intergenic
1130501917 15:84504862-84504884 CTGCAGCAGCTGTGGAGGGCCGG - Intergenic
1130596248 15:85252244-85252266 CTGCAGCAGCTGTGGAGGGCCGG + Intergenic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1130977141 15:88785340-88785362 CAGCAGGGGCTGTGGGAGGCAGG + Intergenic
1131067746 15:89444717-89444739 CTTCAGATGGAGTGGGGGGCAGG - Intergenic
1131175366 15:90205956-90205978 GAGCAGAACCAGTGAAGGGCAGG - Intronic
1131862646 15:96670569-96670591 CAGCAGAAGGAGTTGGGAGGAGG + Intergenic
1202974863 15_KI270727v1_random:280664-280686 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1132678647 16:1130867-1130889 GGCCAGATGCAGTGGGGGGCCGG + Intergenic
1132722034 16:1321219-1321241 CAGGCGGAGCAGTGGGGGGTCGG - Intronic
1133091073 16:3404079-3404101 CAGCAGAAGTAGGTGGGGGGTGG + Intronic
1133245307 16:4444737-4444759 CAACAGAAGCTGTGCGGGGCAGG - Intronic
1133288279 16:4701481-4701503 CAGCAGCAGCAGCGAGGGCCTGG - Exonic
1133324314 16:4934245-4934267 CAGCTGAAGCTGGGGAGGGCCGG - Intronic
1133491090 16:6268868-6268890 CCGCAGTATCAGTGGGGGACTGG + Intronic
1133507777 16:6429307-6429329 CAGCAGCAGTGGTGGGGAGCTGG - Intronic
1133544156 16:6788769-6788791 CAGAAAAATCAGTGGGGGGCCGG - Intronic
1134482122 16:14629510-14629532 AAGCATAAGAAGTTGGGGGCTGG + Intronic
1135294714 16:21269326-21269348 CATGAGACGCAGTGGGGGGAAGG + Intronic
1135839433 16:25861203-25861225 CAGCAGAAGCAGTGAGGTCCTGG + Intronic
1136265104 16:29111580-29111602 CAGCACCAGCAGAGCGGGGCAGG + Intergenic
1136452041 16:30359035-30359057 CACCATAAGCAGCTGGGGGCTGG - Intronic
1136598143 16:31265862-31265884 CACCAGCAGCTGAGGGGGGCTGG - Exonic
1137626904 16:49914816-49914838 CTGCAGAAGAGGTGGGGGGAGGG + Intergenic
1137750528 16:50858209-50858231 AAGGAGAAGCAGTGGAGGCCGGG + Intergenic
1137893441 16:52185780-52185802 CAGCAGAAGCAGTGGAAGCATGG - Intergenic
1137967085 16:52946283-52946305 CACCAGAACCTGTTGGGGGCTGG - Intergenic
1138162321 16:54765839-54765861 CAGCGGTAGGGGTGGGGGGCAGG + Intergenic
1138409116 16:56823853-56823875 CAGCAGTAGCACAGTGGGGCTGG + Intronic
1139530764 16:67541671-67541693 CAGAAGAAGCAGCTGAGGGCTGG - Exonic
1139957804 16:70701446-70701468 CAGCAGAGGGACTGGGGGTCAGG - Intronic
1140797779 16:78456144-78456166 CAACAGAGGCTGTGGGTGGCAGG - Intronic
1141622995 16:85247049-85247071 CAGCAGCAGCCCTGGGGGGTGGG - Intergenic
1141635655 16:85312676-85312698 CAGAAGAAGCAGGGAGGGGGAGG + Intergenic
1141637126 16:85320110-85320132 AAGGAGAAGCAGTCGGGGCCGGG + Intergenic
1141703857 16:85654289-85654311 CAGGAGCAGCAGTGGAGGTCGGG + Exonic
1142053901 16:87979555-87979577 CAGCACCAGCAGAGCGGGGCAGG + Intronic
1142220941 16:88854636-88854658 CAGCAGACCCAGTGGGAGGTTGG - Intronic
1142235346 16:88919836-88919858 CAGGAGTTGCAGTGTGGGGCGGG - Intronic
1142564030 17:827881-827903 CATCCGAAGCGGTGAGGGGCAGG + Intronic
1142740688 17:1930298-1930320 CTGCAGAAGCAGTGGCTGGCGGG + Intergenic
1142996063 17:3761304-3761326 CGGCAGATGCAGTGGGACGCAGG - Intronic
1143334483 17:6162118-6162140 CAGCAGAATCGGGGAGGGGCGGG - Intergenic
1143405671 17:6675671-6675693 CACCAGGAGAAGAGGGGGGCTGG - Intergenic
1144329441 17:14211064-14211086 AAGTAGAAGCAGTGGGGTGGTGG - Intergenic
1144648384 17:16990749-16990771 TGACTGAAGCAGTGGGGGGCAGG - Intergenic
1144754670 17:17671834-17671856 GAGCAGAGGCAGTGGAGGGTTGG + Intergenic
1144764977 17:17727634-17727656 AAGCAGATGCAGTGAGGGGGTGG + Intronic
1145846333 17:28041969-28041991 CAGCAGAAGCAGCCGGCGGCGGG + Intronic
1146508258 17:33424053-33424075 CAGGAGATGCCTTGGGGGGCTGG + Intronic
1146838936 17:36136056-36136078 CAGCAGAGGCTGTGGAAGGCAGG + Intergenic
1147124243 17:38354702-38354724 CATCAGATGCAGGGGAGGGCGGG + Intronic
1147381896 17:40061273-40061295 CAACAGCTGCAGTGTGGGGCAGG - Intronic
1147848948 17:43426337-43426359 AAGCAGAAGCAGTGGTGTGCTGG + Intergenic
1148029125 17:44608026-44608048 CAGCAGGAGCTCTTGGGGGCAGG + Intergenic
1148053964 17:44782475-44782497 TAAAAGAAGCAGTTGGGGGCAGG + Intergenic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1148349743 17:46932001-46932023 CAGCAGAATCTGAGGGGGCCAGG - Intronic
1148647170 17:49225720-49225742 CAGGAGAAGCAGTGGGGCTTGGG + Intronic
1148835761 17:50464949-50464971 CAGCAGAGGCTGTGGGGAGAAGG + Exonic
1149429097 17:56582474-56582496 CAGCAGAAGCAATTCAGGGCAGG - Intergenic
1149561720 17:57612168-57612190 GTGCAGAAGCAGCGAGGGGCAGG + Intronic
1151338078 17:73452027-73452049 TAACAGGAGCAGTGGGGGGAAGG - Intronic
1152245159 17:79181645-79181667 CAGCAGTGGCAGAGGGTGGCCGG - Intronic
1152495596 17:80669126-80669148 CAGCAGGAGCAGCCAGGGGCTGG + Intronic
1152611016 17:81315048-81315070 CAGCAGAGACCCTGGGGGGCGGG - Intronic
1152629235 17:81402561-81402583 CAGCAGAGGGAGGGGCGGGCTGG - Intronic
1152806086 17:82357009-82357031 CAGCAGGAGCGGTGTGGGACCGG - Intergenic
1152864323 17:82713134-82713156 CACCAGCAGCAGTGGGGAGGTGG - Intergenic
1153010249 18:532178-532200 CAGCAGAAGCAGCGTGGGGTGGG + Intergenic
1153661516 18:7330369-7330391 CAGCAGAAGAAGAGGAGGTCAGG - Intergenic
1155086887 18:22467603-22467625 CAGGAGCAGCAGGAGGGGGCTGG + Intergenic
1155433367 18:25785609-25785631 CAGCAGAGGCAGAGGGGAGAGGG - Intergenic
1156093818 18:33505101-33505123 CAGGTCAAGCAGTGGGGGGCGGG - Intergenic
1156382730 18:36578633-36578655 CAGCAGAATCCTTGGGAGGCAGG - Intronic
1156424834 18:36998416-36998438 CAGCAGGAGCAGTGGTGTACTGG - Intronic
1157610075 18:48950534-48950556 CAGCAGCAGCAGCAGGGGCCCGG + Exonic
1160512081 18:79458343-79458365 CAGGAGACGCCGTGGGGAGCAGG + Intronic
1160865099 19:1252850-1252872 CAGCAGCAGCAGTGGCGTGGGGG + Intronic
1160887248 19:1355563-1355585 CAGCAGAAGCGGGGGGGCTCAGG - Intronic
1160979934 19:1812191-1812213 CAGGAGAGGCAGGGGGGGGCAGG + Exonic
1161080897 19:2309636-2309658 TAGAAGATGCAGTGAGGGGCCGG - Intronic
1161298638 19:3532305-3532327 CAGCAGGAGGAGTGTGGGGTGGG + Intronic
1162066994 19:8131830-8131852 CTGCAGAAGCAGTGGCGGCACGG + Intronic
1162784521 19:13025936-13025958 CAGAAGAAGTATTGAGGGGCAGG + Intronic
1163045872 19:14641485-14641507 CTGCAGATGCAGTGAGGTGCTGG + Exonic
1163059802 19:14752395-14752417 CTGCAGATGCAGTGAGGTGCTGG + Exonic
1163090291 19:15014711-15014733 CAGGAGACTCAGTGGGGGGGCGG + Intronic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163827215 19:19530380-19530402 CAGCAGCAGCTGTGGGGTGGGGG - Intronic
1164576245 19:29407047-29407069 CATCAGAACCAGAGGGGTGCTGG - Intergenic
1164730028 19:30496626-30496648 CAGCAGAGGCAGTTGGGGGAAGG + Intronic
1164820130 19:31243608-31243630 TAGCAGAAGCAGAGGGGGTGGGG + Intergenic
1165291506 19:34889780-34889802 CTGCAGAAGCAGTGATGGGTTGG - Intergenic
1165293548 19:34907843-34907865 CTGCAGAAGCAGTGGTAGGTGGG - Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166387514 19:42390435-42390457 CAGGAGGAGAAGTGGGGGGATGG - Intergenic
1167376605 19:49115338-49115360 CACCAGGAGCAATGGGGTGCGGG - Intronic
1167390244 19:49190194-49190216 CAGCAGAGACTGTGGGGGGTGGG - Exonic
1167610556 19:50506025-50506047 CAGCAGCGGCAGTGGGGAGCAGG + Exonic
1167910746 19:52699836-52699858 AAGCTGCAGCAGTGGGGAGCTGG + Intergenic
1167918400 19:52761106-52761128 AAGCTGCAGCAGTGGGGAGCTGG + Intergenic
1168162511 19:54521026-54521048 CATCAGCAGCAGTGAGGGTCTGG + Intergenic
1168720067 19:58549989-58550011 CAGCTGATGCAGGGGGCGGCAGG - Exonic
925023303 2:588318-588340 CAGCAGAAGGTGGAGGGGGCGGG + Intergenic
927069895 2:19517166-19517188 TGGCAGAAGCAGTGGAGAGCAGG - Intergenic
927943730 2:27122180-27122202 CAGGAGAAGCAGTTTGGGACTGG + Intergenic
928067120 2:28175724-28175746 CAGCAGTGGCAGTGGTAGGCTGG - Intronic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929945700 2:46370177-46370199 CAGCTGAGGCAGTGGAGGGTGGG + Intronic
930121999 2:47768117-47768139 CAGCCCAAGCAGTGGGGACCCGG + Intronic
930651798 2:53970995-53971017 CAGCAGAGCCGGTGCGGGGCGGG - Intronic
932187778 2:69713715-69713737 CAGCAGAAGCAATGGAAGGATGG - Intronic
932684886 2:73860294-73860316 CATGAGAAGCAGTGTGGGACAGG + Intronic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
935128125 2:100241678-100241700 CAACAGTAGGAGTGAGGGGCAGG - Intergenic
935217835 2:100988748-100988770 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935217866 2:100988840-100988862 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935217921 2:100988988-100989010 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
936479990 2:112877252-112877274 GAGCAGAAGCACTAGTGGGCTGG + Intergenic
936886681 2:117318868-117318890 CAGCAGAGGCCCTGGGGAGCAGG - Intergenic
937027358 2:118710753-118710775 CAGCAGCAGCAGGGGGTGGCAGG - Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938982952 2:136543977-136543999 CAGCAGTAACAGTGGCAGGCAGG + Intergenic
940518570 2:154713475-154713497 CAGCAGGAGTGGTGGGGGGAGGG + Intronic
940854737 2:158721168-158721190 CATCAGAAGCACTTGGGGGAGGG - Intergenic
943827446 2:192414155-192414177 AGGCAGCAGCAGTGGTGGGCTGG - Intergenic
945052412 2:205836575-205836597 CAGCAGAAGCAGCGGGGGTGGGG - Intergenic
945400625 2:209378015-209378037 CAGCAGCAGAAGTGGTAGGCAGG + Intergenic
946338870 2:219056000-219056022 CTGCATAGGAAGTGGGGGGCAGG - Intronic
948536310 2:238650255-238650277 CCGCAGGAGCAGTCAGGGGCTGG + Intergenic
948611255 2:239168647-239168669 CTGGAGGAGCAGTGGCGGGCCGG - Intronic
1169130905 20:3166015-3166037 CGGCAGCAGCGGTGGGGGGTCGG - Exonic
1170064684 20:12298792-12298814 TGGCAGTAGCAGTGGAGGGCTGG + Intergenic
1170116502 20:12865857-12865879 CATCAGCACCAGTGGGGAGCTGG + Intergenic
1170154152 20:13254455-13254477 CAGCAGGAGATGCGGGGGGCAGG - Intronic
1170531749 20:17300158-17300180 CAGCAGAAGGGGTGGGAGTCAGG - Intronic
1170573613 20:17646905-17646927 CAGCAGCTGATGTGGGGGGCTGG - Intronic
1170737568 20:19025027-19025049 CATCAGAAGCTGTGGGGGTGGGG - Intergenic
1170921410 20:20683179-20683201 GAGCAGAAGCAGTCCAGGGCTGG - Intronic
1171091615 20:22290729-22290751 GAGCAGATGCTGTGGGAGGCTGG + Intergenic
1171412001 20:24953691-24953713 CATTAGAAGCAGTGGTGGGCTGG + Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172443270 20:34980032-34980054 CAGCTGTAGCAGTGCGGGGCGGG + Intronic
1172809530 20:37637331-37637353 CTGCAGAGGCAGTGAGGGGCAGG + Intergenic
1172890539 20:38260782-38260804 CAGCAGAGGCGGGGCGGGGCGGG + Intronic
1173645752 20:44632161-44632183 CAGCAGAAGCCTTGGGGTGGGGG + Intronic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1174298164 20:49563327-49563349 CAGTGGTAGCAGTGCGGGGCAGG - Intronic
1175430825 20:58901838-58901860 GAGCAGCAGGGGTGGGGGGCGGG - Intronic
1175625579 20:60486063-60486085 CAGCAGAGGCAGCTGGGGGTGGG + Intergenic
1175786128 20:61712710-61712732 CAGCAGGAGCCGTGGCGAGCTGG + Intronic
1177400398 21:20595602-20595624 CAGCAGAAGAAATTCGGGGCCGG - Intergenic
1179613993 21:42569930-42569952 CAGCAGCAGCAGCGTGGAGCTGG - Intronic
1179883315 21:44302463-44302485 CGGCAGCAGCAGTGGTGGCCTGG - Intronic
1179981990 21:44900478-44900500 GAGAAGAAGGCGTGGGGGGCAGG + Intronic
1180155909 21:45977388-45977410 CAGAAGCAGCTGTGGGGAGCAGG - Intergenic
1180635972 22:17263303-17263325 CTGCAGAAGCACTGAGGGTCGGG - Intergenic
1180701115 22:17781857-17781879 CTGCAGAAGCTCTGGGAGGCTGG + Intergenic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181171927 22:21014832-21014854 CAGCAGCAGCAGGGCGGGGAGGG - Intronic
1181407869 22:22697624-22697646 CAGCAGAGGCACTGAGGGCCAGG + Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182302155 22:29342958-29342980 CTGCAGAAGCATGGGGGGTCTGG - Intronic
1182308528 22:29388375-29388397 CAGGAGAAGAAGTGGGGCGAGGG - Intronic
1183379793 22:37485237-37485259 CGGCTGAGGCAGTGGTGGGCCGG - Intronic
1183758973 22:39798743-39798765 CAGCAGTGGCAGTGGTGAGCTGG + Intronic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1184645116 22:45891256-45891278 TAGCAGAGGCTGTGGGGGGCCGG - Intergenic
1184668631 22:46001516-46001538 GAGCAGGTGCAGTGAGGGGCTGG - Intergenic
1184726144 22:46347799-46347821 CAGCAGAAGCAGCAGGGGCTGGG - Intronic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185155279 22:49189976-49189998 GAGCAGAAGCAGTGAGTGCCAGG + Intergenic
1185187522 22:49411269-49411291 CAGCAGTGGCAGTGGGGGGGGGG - Intergenic
1185321333 22:50201439-50201461 CCGCAGTAGCAGTGCGCGGCGGG - Exonic
949376869 3:3400571-3400593 CAGCAGTGGCAGTGGGGTGGTGG + Intergenic
949934084 3:9102921-9102943 CAGCAGCAGCAGGCGGGGGCTGG + Intronic
949980265 3:9498421-9498443 CAGCAGCAGCAGAAGGGGTCAGG + Exonic
950660100 3:14461870-14461892 CAGCAGCAGCAGGGGGAGCCAGG - Intronic
950722187 3:14891310-14891332 CAGCAGGTGCAGAGGGCGGCTGG - Intronic
951566919 3:24020141-24020163 GGGCTGAGGCAGTGGGGGGCTGG + Intergenic
952327531 3:32334864-32334886 CAACTGAGGCAGTGGAGGGCAGG - Intronic
952956667 3:38562059-38562081 CAGCAGAAGCACAGGGGCCCTGG + Intronic
954358403 3:50102597-50102619 AAGCAGAAGGTGTGGGGGGAAGG + Intronic
954391288 3:50269317-50269339 GAGCCGAAGGCGTGGGGGGCTGG - Exonic
955045205 3:55353086-55353108 CATCAGAATCACTGGGGTGCGGG + Intergenic
956249216 3:67218195-67218217 CAGCAGTGGCAGTGGGTGGGTGG - Intergenic
957080812 3:75634129-75634151 CAGCATAGGCAGCGGGGGACAGG - Intergenic
958022167 3:88011117-88011139 AAGCAGAAACTGTGGGAGGCAGG + Intergenic
959585744 3:108023596-108023618 CAGCACCAGCAGAGTGGGGCAGG - Intergenic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961556583 3:127700428-127700450 CAGCAGAGTCTGTGGGGGTCTGG - Intronic
961716965 3:128864434-128864456 CAGCAGAATCAATAGGGGGGAGG - Intergenic
961986520 3:131140442-131140464 CAGCAGATGCTGTGGGGAGCAGG + Intronic
964656778 3:159075928-159075950 GAGCAGAAGCAGTGATTGGCTGG + Intronic
967000602 3:185330556-185330578 GAGGAGAAGGAGTGGAGGGCTGG + Intronic
967035350 3:185645283-185645305 CTGCAGAAGCCCTGGGGGGCGGG + Exonic
968435121 4:581109-581131 CAGCAGAAGCTCTGGTGGGAGGG - Intergenic
968503210 4:960678-960700 AAGCAGAAGCCGAGGAGGGCCGG - Exonic
968899407 4:3423979-3424001 CAGCAGGTGCAGTGGGGGCAGGG - Intronic
968967852 4:3778345-3778367 CAGCAGCAGCAGCTGGGAGCGGG + Intergenic
969166628 4:5321802-5321824 AGGCAGAGGCAGTTGGGGGCAGG - Intronic
969194118 4:5547222-5547244 GGGCTGAGGCAGTGGGGGGCTGG - Intronic
969636015 4:8369944-8369966 CCCCATAAGCAGTGGGGTGCTGG + Intronic
969711888 4:8849449-8849471 CATCAGAAGCTGGAGGGGGCAGG + Intronic
969969315 4:11029298-11029320 CAGCACCAGTAGTGGGGGGCTGG - Intergenic
970600415 4:17637320-17637342 CTGAAAAAGCAGTGGGGGCCGGG - Intronic
971114766 4:23631854-23631876 CTTCAAAAGCAGTGGTGGGCAGG - Intergenic
976141001 4:81991497-81991519 CAGCAGCAGCAGTGGGGGTGGGG + Intronic
976786100 4:88823333-88823355 GAGCAGAAGGAGTAGGGTGCGGG - Intronic
977178276 4:93840930-93840952 CAGCAGAGGCAGGGAGGTGCAGG + Intergenic
977801394 4:101237752-101237774 CAGCAGATGCTGTGGGGCACTGG + Intronic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
981582546 4:146264648-146264670 CAGCAGGAGTTGTGAGGGGCTGG - Intronic
981627609 4:146776882-146776904 CAGCAGTGGGAGTGGGGTGCTGG + Intronic
981808169 4:148740959-148740981 CAGCACAGGCAGTGCAGGGCTGG + Intergenic
982068437 4:151674323-151674345 CAGCAGAAGCACTGGGGACCTGG + Intronic
985435120 4:189921657-189921679 CAGCAGAAGCAATGTGGGCCAGG + Intergenic
985450097 4:190057079-190057101 CAGCACAGGCAGCGGGGGACAGG + Intergenic
985861624 5:2476030-2476052 CAGCAGAAGCAGAGGGGGTCTGG + Intergenic
986755411 5:10831589-10831611 CTGCAGAAGCACTGGGTGGAGGG - Intergenic
988029040 5:25739077-25739099 CAGCAGTGGCAGTGGCAGGCAGG - Intergenic
988208232 5:28168600-28168622 CAGAAGAAACAATGGGGAGCAGG - Intergenic
988424702 5:31050025-31050047 AAGCAGAAGCATTGAGGTGCCGG + Intergenic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
988906469 5:35795891-35795913 CAGCAGAGGAATTGAGGGGCAGG - Intronic
989199527 5:38750031-38750053 CAGCAGAGGAAGTTGGGGGAGGG - Intergenic
989633947 5:43514899-43514921 CTGAAGAAGCAGTGGTGGGCAGG - Exonic
990681050 5:58244891-58244913 TAGCAGCAACAGTGGGAGGCAGG + Intergenic
991057281 5:62334488-62334510 GAGGAGGAGAAGTGGGGGGCAGG - Intronic
991117408 5:62970174-62970196 GAGAGGAAGCAGTGGTGGGCAGG - Intergenic
991261379 5:64671905-64671927 AACCAGAGGCAGTGGGAGGCAGG + Intergenic
992983533 5:82202930-82202952 CAAAAGAAGTAATGGGGGGCTGG + Intronic
994220818 5:97193010-97193032 CTGCAGCTGCTGTGGGGGGCAGG + Intergenic
995016402 5:107314344-107314366 CAGCAGAAACAGGGAGGAGCTGG + Intergenic
996723092 5:126648857-126648879 CAGCTGAAGAAGTGGGGTGGTGG - Intergenic
997183499 5:131857956-131857978 CAGCAGCAGCAGTGGTGGGCTGG - Intronic
997230665 5:132239963-132239985 CAGAAGTAGCAATGGGTGGCAGG + Intronic
999426183 5:151489513-151489535 CCACAGAGGCAGTGTGGGGCCGG - Exonic
999959116 5:156735369-156735391 TCCCAGAGGCAGTGGGGGGCAGG - Intronic
1000338579 5:160260125-160260147 CAGCAGCAGCAGCCAGGGGCTGG + Intronic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001342916 5:170863272-170863294 CAGGGGAGGCAGTGGGTGGCAGG + Intronic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001984543 5:176061879-176061901 CAGCACAGGCAGTGGGGTGGGGG + Exonic
1002060333 5:176621855-176621877 CAGCAGACGCAGCGGGTGGGGGG - Intronic
1002232971 5:177782318-177782340 CAGCACAGGCAGTGGGGTGGGGG - Exonic
1002883155 6:1270831-1270853 CAACAGATGCAGTGGCGTGCTGG - Intergenic
1003030824 6:2599090-2599112 GGGCAGGAGCAGTGAGGGGCAGG - Intergenic
1003301577 6:4888762-4888784 CAGCAAAAGCAGTGATGGGAGGG - Intronic
1003377493 6:5593293-5593315 CAGCAGAGGCCGGTGGGGGCGGG - Intronic
1004145135 6:13058887-13058909 AGGCAGAATCAGTGGGGAGCTGG - Intronic
1005357270 6:24996560-24996582 AAGCAGAAACAGTGGTGGGAGGG - Intronic
1006437620 6:34034390-34034412 CAGCAGATGCAGTGGGGAGTGGG - Intronic
1006502128 6:34465879-34465901 CGGCTGAAGCAGCGGGGAGCCGG + Intergenic
1006937550 6:37728957-37728979 CAAGAGAAGCAGGGGAGGGCAGG + Intergenic
1007099968 6:39239433-39239455 GAGCAGTAGCAGTGGGAAGCAGG + Intergenic
1007358206 6:41335890-41335912 CAGCAGTAGCAGTGGGTGTAGGG - Exonic
1007747646 6:44052866-44052888 CAGCAGGTGCAGTGTGGAGCTGG + Intergenic
1008193133 6:48484623-48484645 TAGCAGATGCAGTGGGTGGTAGG - Intergenic
1009814228 6:68710335-68710357 CAGCAGAAGAGGTGGGAGCCTGG - Intronic
1010177908 6:73051191-73051213 CAGCAGTGGCAGCGTGGGGCAGG - Intronic
1011485297 6:87834716-87834738 CAGCAGAAGCCCTGGGGACCTGG - Intergenic
1011659698 6:89583738-89583760 CTGCATAGGCAGTGAGGGGCAGG - Intronic
1011746675 6:90413458-90413480 TAACAGGAGGAGTGGGGGGCGGG - Intergenic
1011798592 6:90983753-90983775 CACCAGAAGCAGGAAGGGGCAGG - Intergenic
1012616424 6:101284132-101284154 CAGCAGAAGCAGTGGCAGAGAGG - Intergenic
1013466506 6:110421865-110421887 CAGTAGAATCAGTGGGGGTGTGG + Intergenic
1014134389 6:117871274-117871296 AAGCGGAAGGAGTGGGGGGCAGG + Intergenic
1014175367 6:118325918-118325940 CGGCAGAAGCAGTTGTGGCCAGG - Intergenic
1015843995 6:137498590-137498612 CAACAATAGCAGTGGGGGTCCGG + Intergenic
1016429601 6:143968854-143968876 TGGCAGGAGCACTGGGGGGCAGG + Intronic
1017125490 6:151060531-151060553 GAGCAGATGCCATGGGGGGCTGG + Intronic
1018794274 6:167173897-167173919 CAGCGGCAGCAGTGGGAAGCCGG + Exonic
1018822045 6:167381170-167381192 CAGCGGCAGCAGTGGGAAGCCGG - Exonic
1018853889 6:167662184-167662206 AAGCAGACGCCGTGGAGGGCGGG + Intergenic
1019032298 6:169024118-169024140 CAGCAGAAGCAGAGGGGCAGCGG + Intergenic
1019174187 6:170151713-170151735 CAGCAGAAGGAGACAGGGGCAGG - Intergenic
1019442901 7:1056366-1056388 CAGCAGCCGCAGTGAGGGTCAGG - Intronic
1019552469 7:1610026-1610048 CAGGAGGAGAAGCGGGGGGCTGG + Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020042105 7:5012125-5012147 CAGCAGAAGCAATGGAAGGATGG - Intronic
1021628876 7:22623914-22623936 CAGCAGAAGTAGGAAGGGGCAGG + Intronic
1021765552 7:23944407-23944429 CAGCAGTGGCAGTGGTGGACTGG - Intergenic
1021993614 7:26159161-26159183 CAGCAAGAGCAGCTGGGGGCTGG - Intronic
1022589088 7:31643774-31643796 CAGCAGATGCAGCAGTGGGCAGG - Exonic
1023036526 7:36135948-36135970 CAGGAGAGGCAGTGGGTGGCAGG + Intergenic
1023507290 7:40913247-40913269 CACCATAAGCAGTGGGGCTCAGG + Intergenic
1023719360 7:43077412-43077434 CTGCAGCAGCAGTGCGTGGCTGG + Intergenic
1023857755 7:44195068-44195090 CAGCAGAACCTTTGGGGAGCTGG - Intronic
1024736319 7:52308760-52308782 CACCAGATGCGGTGGGGGGTGGG + Intergenic
1024754495 7:52513663-52513685 CAGCACGAGCAGTGAGGGGAGGG + Intergenic
1025280454 7:57623227-57623249 GAGCAGAGGGAGTGGGTGGCTGG - Intergenic
1025304277 7:57842280-57842302 GAGCAGAGGGAGTGGGTGGCTGG + Intergenic
1026459889 7:70604663-70604685 CAGCAGAGGCAGAGGTGAGCAGG - Intronic
1027222152 7:76220890-76220912 CAGAAGACGCGGTGGGGGGAGGG - Intronic
1028519015 7:91708085-91708107 CAGTAGTGGCAGTGGTGGGCTGG - Intronic
1028915187 7:96251264-96251286 CAGCAGATGAAGTGAGGGGCTGG + Intronic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1030354477 7:108526825-108526847 CAGCAGAACCTGCGGTGGGCTGG - Intronic
1032628406 7:133619807-133619829 CAGCAGAAGCACTGGGGAACTGG - Intronic
1032947416 7:136869751-136869773 CAGTAGAGGGAATGGGGGGCTGG - Intronic
1033412584 7:141132593-141132615 CAGCAGTGGCAGTGGCAGGCTGG - Intronic
1034256893 7:149729637-149729659 AAGCAGCAGCAGTGGACGGCGGG - Intronic
1034282672 7:149864787-149864809 CAGCAGAAGCAGTGAGGCCGTGG + Exonic
1034562386 7:151889465-151889487 CTGCAGAAGAAGTAGGGGCCAGG + Intergenic
1034967582 7:155400729-155400751 CTGCAGAGGGAGTGGGGGACAGG - Intergenic
1034997266 7:155585905-155585927 CTGCAGGTGCAGTGGGGGCCAGG - Intergenic
1035068495 7:156124555-156124577 CAGCACAAGGAGGTGGGGGCGGG - Intergenic
1035365368 7:158345861-158345883 CGGCAGAAGGAGTGGGGGTGGGG + Intronic
1035771945 8:2154810-2154832 GTGCAGAGGCAGTGAGGGGCTGG - Intronic
1037591137 8:20313135-20313157 CAGCAGAGGCAGTGGCGGCAGGG - Intergenic
1039385718 8:37134025-37134047 CAGCAGAGCAAGTGGGGAGCTGG - Intergenic
1041359043 8:57030893-57030915 CAGCACCAGTAGTGGGAGGCAGG - Intergenic
1041928552 8:63263675-63263697 CAGCAGAAGCAGCTGGTGGATGG + Intergenic
1042764747 8:72308761-72308783 CAGCAGCAGCAGTGGGGGTGTGG + Intergenic
1042874376 8:73427276-73427298 CGGCAGCAGCAGTGGGAGGAGGG + Intronic
1043310080 8:78847938-78847960 CAGCAGAAGCAGGTGGGGGGGGG + Intergenic
1044644228 8:94421066-94421088 AAGCAGAGGCAGTGTGGGGGTGG - Intronic
1045681496 8:104665697-104665719 TAGCAGAAGAAGTGGTGGGTGGG - Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1048109663 8:131454046-131454068 CAGCAGATGTGGTGGGGGACAGG - Intergenic
1048589442 8:135807592-135807614 GGGCAGGAGGAGTGGGGGGCTGG + Intergenic
1048876126 8:138838059-138838081 CAGCAGAAGCAGTGGCGTGGAGG + Intronic
1048971735 8:139648862-139648884 CAGGAAAGGCAGTGGGGGGATGG - Intronic
1048980908 8:139703138-139703160 CAGCAGCAGCAGCGGGGAGGCGG + Intergenic
1049015776 8:139918971-139918993 CAGCAAAAGCAGGGAGGAGCCGG + Intronic
1049016204 8:139921881-139921903 CAGATGTGGCAGTGGGGGGCAGG - Intronic
1049418763 8:142507557-142507579 CAGCAGGAGCCCTGGGGGCCGGG + Intronic
1049478579 8:142808232-142808254 CAGCAGCAGCAGCAGTGGGCTGG + Intergenic
1049494274 8:142922459-142922481 CAGCATCAGCAGGGAGGGGCAGG - Intergenic
1049586583 8:143435262-143435284 CAGCAGGAGCAGGGTGGGGGTGG - Intergenic
1049593048 8:143471313-143471335 CAGAAGAGGCAGTGTGGGGCGGG + Intronic
1049694642 8:143977308-143977330 CAGCAGCGGCCGAGGGGGGCCGG - Exonic
1050037648 9:1454212-1454234 CAGCAGAGGCAGTGAGGAGAGGG + Intergenic
1052142414 9:25003854-25003876 CAGCTGAGGCAGAGGGTGGCGGG + Intergenic
1052772354 9:32701362-32701384 CAGCAGAATCAGTGAGCAGCTGG + Intergenic
1053009425 9:34624813-34624835 CAGCTGGAGCGGTGGGAGGCAGG + Intronic
1053020522 9:34691046-34691068 GGTCAGAGGCAGTGGGGGGCTGG - Intronic
1053147814 9:35723847-35723869 AAGAAGAAATAGTGGGGGGCAGG + Intronic
1056786368 9:89595182-89595204 CAGCAGGAGCAGAGGCGAGCTGG + Intergenic
1057532001 9:95857176-95857198 CAGCAGAAGTGATGGGGGGGAGG + Intergenic
1057759418 9:97860575-97860597 CAGAAGAGGGAGTGTGGGGCTGG - Intergenic
1059795351 9:117688793-117688815 CATCAGAAACAATGGGAGGCCGG + Intergenic
1060180711 9:121531777-121531799 CAGCAGCAGGACTGAGGGGCAGG + Intergenic
1060554280 9:124500333-124500355 CAGCCCAGGCTGTGGGGGGCTGG + Exonic
1060796833 9:126517603-126517625 CAGCAAACGAAGTGGGGCGCGGG - Intergenic
1061043663 9:128153214-128153236 CAGCAGCAGTGCTGGGGGGCAGG - Intronic
1061084108 9:128389425-128389447 CAGCAGCCTCAGTGTGGGGCTGG - Exonic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061570932 9:131477037-131477059 CAGCAAACGCAGAGGGGAGCAGG + Intronic
1062014218 9:134283160-134283182 CAGCAGAGGCGGGGAGGGGCAGG - Intergenic
1062390573 9:136332089-136332111 CAGCAGCAGCGGGCGGGGGCGGG - Intronic
1186137444 X:6534282-6534304 CCTCAGAAGCGGTGGGGGCCGGG + Intronic
1186266989 X:7843397-7843419 CCTCAGAAGCGGTGGGGGCCGGG - Intronic
1186298116 X:8170428-8170450 CCTCAGAAGCGGTGGGGGCCGGG + Intronic
1186324678 X:8465644-8465666 CCTCAGAAGCGGTGGGGGCCGGG - Intronic
1186851545 X:13584897-13584919 GAGCAGAAGCAGTGGAGGTAAGG - Intronic
1187326567 X:18295604-18295626 CAGCAGTGGCAGTGGTGGGCTGG - Intronic
1187367076 X:18674667-18674689 CATGAGAAGTAGTGGAGGGCAGG - Intergenic
1187447630 X:19373014-19373036 GAGCAGAAGGAGGGGGAGGCGGG + Intronic
1188722916 X:33544577-33544599 CAGCAGTGGCAGTGGTAGGCTGG - Intergenic
1189258715 X:39661281-39661303 CGGCTGTAGCAATGGGGGGCTGG + Intergenic
1189451356 X:41134800-41134822 CAGATGAAGCAGTGAGTGGCTGG + Exonic
1189926467 X:45960089-45960111 CAGCAGCAGGGGTGGGGTGCTGG - Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1191816809 X:65254137-65254159 CAGCAGTGGCAGTGGGGGGGTGG - Intergenic
1191842539 X:65523559-65523581 CATCCGAAGGAGTTGGGGGCTGG + Exonic
1191865244 X:65698568-65698590 CAGCAGAAGCAGTGGGGGGCAGG - Intronic
1192189178 X:68980324-68980346 CAGCAGAAGTAGTTGGGGCATGG + Intergenic
1193488901 X:82122915-82122937 CAGCAGTAGCACTGTGGGGTGGG + Intergenic
1193970044 X:88039611-88039633 CAGCAGCAGCAGTGGTGGGAAGG - Intergenic
1194446316 X:93991451-93991473 CACCAGAACCAGTCGGGGGGTGG + Intergenic
1194838235 X:98708498-98708520 CAGCAGAAGCCGTTGGGTGGTGG + Intergenic
1197167208 X:123391652-123391674 CAGCAGCGGCAGTGGTGGGCCGG + Intronic
1197551111 X:127893907-127893929 CAGCAGAAGCAAGGGGTGGGGGG - Intergenic
1198122842 X:133611046-133611068 CAGGAGAATCAGTTGAGGGCAGG + Intronic
1198254139 X:134910649-134910671 CTGCAGTAGAAGTGGAGGGCCGG + Intronic
1198275584 X:135095377-135095399 CAGCAGAAGCCACGGGGGGTGGG + Intergenic
1198934878 X:141895242-141895264 CAGCAGAGGCAGCGTGGGGTGGG - Intronic
1199270025 X:145872577-145872599 CAGCAGTAGCAGGGGGAGCCTGG + Intergenic
1199408035 X:147485611-147485633 CAGCAGATGCAGTGGGGGTGGGG + Intergenic
1199791288 X:151157513-151157535 TTGGAGAAGCAGTGTGGGGCAGG + Intergenic
1200002638 X:153069923-153069945 GGGGAGAAGCGGTGGGGGGCAGG + Intergenic
1200005085 X:153080086-153080108 GGGGAGAAGCGGTGGGGGGCAGG - Intergenic
1200108991 X:153729502-153729524 CGGCAGCAGAAGTGGGCGGCGGG - Intronic
1200138161 X:153884973-153884995 CTCCAGAAGGAGTGGGGGCCTGG - Intronic
1201438791 Y:13986225-13986247 CCTCAGAAGCGGTGGGGGCCGGG + Intronic
1201445782 Y:14056483-14056505 CCTCAGAAGCGGTGGGGGCCGGG - Intronic
1201917562 Y:19198686-19198708 GAGCAGAAGCTGTAGAGGGCTGG + Intergenic