ID: 1191867831

View in Genome Browser
Species Human (GRCh38)
Location X:65719837-65719859
Sequence GGCATGATTTGGAGCCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191867831 Original CRISPR GGCATGATTTGGAGCCTAGT GGG Intronic
903753045 1:25641394-25641416 GACATCATTTGAAGGCTAGTGGG + Intronic
904830312 1:33302192-33302214 GTTAGGAGTTGGAGCCTAGTGGG - Intergenic
906108396 1:43308016-43308038 GGCAGGACTTGGACCCTCGTAGG - Intronic
912224928 1:107722578-107722600 GACATTGTTTGGAGCATAGTAGG - Intronic
912722883 1:112034870-112034892 GGTATGATTTCAAGCCTACTAGG - Intergenic
913358779 1:117955106-117955128 GGCTTGACTTGTAGCATAGTTGG + Intronic
917538892 1:175894717-175894739 CGCATGATTTGTAGCTTAGTTGG - Intergenic
1062906216 10:1181087-1181109 AGCGTGATTTGGAGCCCACTGGG + Exonic
1064223664 10:13463025-13463047 GGAATGATGTGGAGTTTAGTTGG - Intronic
1066477033 10:35757524-35757546 GGCATGATCTGGAGCCAGGAGGG - Intergenic
1069609549 10:69763658-69763680 CCCCTGATTTGGAGCCAAGTGGG - Intergenic
1078699122 11:13664107-13664129 GCCATGATTTGGAGCTCATTTGG - Intergenic
1079326154 11:19494356-19494378 AGAATGATTTGGGGCCTAGGGGG - Intronic
1079403120 11:20122308-20122330 GGCATGGTTTGGAGTCCTGTGGG + Intergenic
1085525946 11:77164019-77164041 GGCCTGACTTTGAGCCTAATGGG - Intronic
1089050150 11:115538854-115538876 GGCATGACTAGGAGCCTACTGGG - Intergenic
1091390733 12:124761-124783 GGCAGAACTTGGAGGCTAGTGGG + Intronic
1092735330 12:11577046-11577068 GGTAGGATTTGGAGTTTAGTAGG - Intergenic
1092830623 12:12441058-12441080 GGCAAGAGTTGGAGCCTTGTGGG + Intronic
1096579969 12:52578652-52578674 GACATGGCTTGGGGCCTAGTTGG + Intergenic
1100464737 12:94834957-94834979 GGCATGCTTTGGAGCCCAGCTGG + Intergenic
1101655048 12:106712645-106712667 GGGATGATTTGGAGACCAGAGGG + Intronic
1105737890 13:23290326-23290348 GGCATTTTTTGGAGCTCAGTTGG - Intronic
1109172887 13:59118031-59118053 GGCATGGTTTGGAGAAAAGTTGG - Intergenic
1118967571 14:70601879-70601901 GGCCTGGTTGGGAGCCTAGTGGG + Intergenic
1120102194 14:80458164-80458186 GGCATTCTTTGTAGCCTATTTGG - Intergenic
1124082496 15:26514963-26514985 GGCATGATCTGCAGCCTCTTAGG - Intergenic
1132277856 15:100584982-100585004 GACAGGATTTGGAGCCTGGGTGG - Intronic
1136381899 16:29899823-29899845 GGCATAATTGGGGGCCTAGCAGG - Intergenic
1137895755 16:52210435-52210457 GGCCTGTGTTAGAGCCTAGTTGG - Intergenic
1139518637 16:67466705-67466727 TGCATGGTTTGCAGCCTAGGTGG + Intronic
1142297473 16:89235236-89235258 GCCCCGATCTGGAGCCTAGTGGG - Exonic
1152299371 17:79486170-79486192 GGCAGGGTTGGGAGCGTAGTTGG + Intronic
1157726050 18:49964880-49964902 GTCATGATATGCAGCGTAGTGGG + Intronic
925307790 2:2862359-2862381 GGCATGGCTTGGAGACAAGTGGG - Intergenic
927542981 2:23928729-23928751 GGAATGATTGGGAGCTTAGATGG - Intronic
927725103 2:25415979-25416001 GCCCTGATTTGTAGCCAAGTTGG + Intronic
928090415 2:28370470-28370492 GTCATGACTTGGAGGCCAGTTGG - Intergenic
929827316 2:45319356-45319378 TGCAGGATTTGGAGCCTCTTTGG - Intergenic
930379094 2:50604816-50604838 GGTATAATTTGGGGCATAGTAGG - Intronic
938245092 2:129770064-129770086 GGCATGATTTGAAGTCTTGGAGG - Intergenic
941929601 2:170926769-170926791 GGGATGATTTTGAGCCCAGGAGG + Intergenic
944203758 2:197135829-197135851 GGCAGGATTTAGTACCTAGTAGG - Intronic
947623878 2:231607472-231607494 GGCATGATGTGGACTCTAGGAGG - Intergenic
1169599755 20:7244374-7244396 GGCATTTTTTGGAATCTAGTGGG - Intergenic
1170045835 20:12084534-12084556 GGCGTGATTTGGATCCTTGAGGG - Intergenic
1170232238 20:14062721-14062743 GGTAGGATTTAGAGACTAGTTGG + Intronic
1170552816 20:17491696-17491718 TGCACGCTTTAGAGCCTAGTTGG - Intergenic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1173872882 20:46352679-46352701 GGAATGATGGGGATCCTAGTGGG + Intronic
1176940086 21:14912888-14912910 GGCAAGCTTTGGAGGCAAGTCGG - Intergenic
1178013479 21:28314836-28314858 GGATTTATTTGGTGCCTAGTTGG - Intergenic
1178631286 21:34263609-34263631 GGAATGATTTGGGGACTGGTGGG - Intergenic
1178717848 21:34982945-34982967 ACCAAGATTTGAAGCCTAGTTGG + Intronic
1180926216 22:19556816-19556838 ACTATGATTTGGAGACTAGTAGG - Intergenic
1182732951 22:32509961-32509983 GGCCTGATTTGGAGCTTGGAAGG + Intergenic
951650973 3:24951194-24951216 ACCATGACTTGGAGCCTGGTTGG - Intergenic
952594566 3:35000380-35000402 GGTATAAGTTGGAGCCTTGTGGG + Intergenic
952869189 3:37882930-37882952 TGCTTGGTTTGGAGCCAAGTTGG + Intronic
961755869 3:129127084-129127106 GGCAGGATCTGGACCCTAGCTGG - Intronic
964307712 3:155358537-155358559 GGCCTGATTTGTAGCCAAATTGG + Intergenic
964496008 3:157290577-157290599 GGCCTGATTTGGAGTGTACTTGG - Intronic
976592589 4:86863763-86863785 GCCATGATCTAGAGCCCAGTGGG + Intergenic
976824254 4:89242256-89242278 GGCATCATTTGAAGCCTCTTTGG + Exonic
979761470 4:124410431-124410453 TGCTTGATTTTGAGCATAGTTGG - Intergenic
986556925 5:9019459-9019481 GTCAGGAGGTGGAGCCTAGTGGG - Intergenic
990739590 5:58898662-58898684 AGCCTGATTTTGAGCCCAGTAGG + Intergenic
995742217 5:115366821-115366843 GGCATGGGTTGGAGACAAGTTGG + Intergenic
999771044 5:154775728-154775750 GGCTTGATCTGGAGCCTTTTGGG + Intronic
1003771931 6:9314744-9314766 GGCATGATTAGGAATCTAGCAGG - Intergenic
1005581929 6:27243396-27243418 GGAATGATTGGTAGCTTAGTTGG - Intergenic
1010359998 6:74982116-74982138 AGTATGATTTGGCACCTAGTAGG + Intergenic
1010740777 6:79501205-79501227 GGCCAGATTTTGAGCCTAGGGGG + Intronic
1012925390 6:105262160-105262182 GGCATGAGCTGGACCCTAGAAGG + Intergenic
1015865981 6:137727161-137727183 AGCATTGTTTGGCGCCTAGTAGG - Intergenic
1021502642 7:21347314-21347336 GCCCTGATTTGTAGCCAAGTTGG + Intergenic
1022404619 7:30076766-30076788 GGCATGACTTGGAGAGTAATAGG - Intronic
1032472125 7:132186201-132186223 GTCATGAACTGGAGCCTAGGGGG - Intronic
1032692553 7:134303564-134303586 TCCATGATATGAAGCCTAGTAGG + Intronic
1033109797 7:138563878-138563900 TGCATGATTTGAATCCCAGTGGG + Intronic
1034671182 7:152859821-152859843 GACTTGGTCTGGAGCCTAGTGGG - Intergenic
1036165332 8:6427588-6427610 GTCAGGAGTTGGAGACTAGTGGG - Intronic
1040281590 8:46053716-46053738 GGGATATTTTGGAGCCCAGTAGG + Intergenic
1042407284 8:68420479-68420501 GGAATGATTTGTGGCCTAGGAGG - Intronic
1046669003 8:117036858-117036880 GGCTGGAATTTGAGCCTAGTTGG + Intronic
1047859413 8:128948122-128948144 GTCATGATTTGGAAGCTAGATGG + Intergenic
1048283041 8:133119473-133119495 GGGAAGATTTGGTGTCTAGTAGG + Intronic
1053076513 9:35138927-35138949 GGCATGAGCTGGCGACTAGTGGG + Intergenic
1062719809 9:138034054-138034076 GGTATGAATGGAAGCCTAGTGGG - Intronic
1203790306 EBV:147980-148002 GGAATGCTTTGGAGCCGAGAGGG + Intergenic
1186011172 X:5134766-5134788 GGTATGAATTGGAGCATAGATGG + Intergenic
1189830757 X:44970793-44970815 GGCATGGTTTGAAGTCTAGAAGG + Intronic
1190445819 X:50522990-50523012 GGCATGATTTGGGCCCAAGCAGG + Intergenic
1191867831 X:65719837-65719859 GGCATGATTTGGAGCCTAGTGGG + Intronic
1192543767 X:71996182-71996204 GGCATGAATGGCAGCCCAGTTGG - Intergenic
1195375241 X:104220426-104220448 GGCATGATTAGGAACCTGGGTGG - Intergenic
1195677934 X:107521737-107521759 GGCAGGATTTGGAACCATGTGGG - Intergenic
1201137177 Y:10998795-10998817 GGAATGAATTGGAGTGTAGTGGG - Intergenic