ID: 1191870395

View in Genome Browser
Species Human (GRCh38)
Location X:65740526-65740548
Sequence CAATTTCTCCCCAGGGTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 2, 1: 0, 2: 2, 3: 23, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191870388_1191870395 10 Left 1191870388 X:65740493-65740515 CCTCAATAAGCCTTGTCGTTGAC 0: 1
1: 1
2: 0
3: 3
4: 87
Right 1191870395 X:65740526-65740548 CAATTTCTCCCCAGGGTGGATGG 0: 2
1: 0
2: 2
3: 23
4: 266
1191870391_1191870395 0 Left 1191870391 X:65740503-65740525 CCTTGTCGTTGACTTTAGGGACT 0: 1
1: 1
2: 0
3: 11
4: 81
Right 1191870395 X:65740526-65740548 CAATTTCTCCCCAGGGTGGATGG 0: 2
1: 0
2: 2
3: 23
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191870395 Original CRISPR CAATTTCTCCCCAGGGTGGA TGG Exonic
900315776 1:2055693-2055715 CAACTTTTCCCCAGTGGGGATGG + Intronic
901296626 1:8165840-8165862 CAACTTCTCCACAAGGTGGCAGG - Intergenic
901395313 1:8976881-8976903 CCATATCGCCCCATGGTGGAGGG + Intergenic
901689668 1:10964483-10964505 CAAATGCTCCCCAGCCTGGAGGG - Intronic
902164151 1:14556141-14556163 CACTCTGTCCCCAGGCTGGAGGG + Intergenic
902728064 1:18350416-18350438 CAACTTCTGGCCAGGGTGGCAGG - Intronic
903624737 1:24722339-24722361 CAAAGTCTCCACAGTGTGGAAGG - Intergenic
904529066 1:31155933-31155955 TGATTTCTCCCCAGGTTAGATGG - Intergenic
905365642 1:37449807-37449829 CAGTTTGTCCCCAGGGAGGAAGG - Intergenic
905586088 1:39119742-39119764 GAATTTCTCCACTGGATGGACGG - Intronic
906516584 1:46442715-46442737 CATGCTCTCCCCAGGGTGGAGGG - Intergenic
906733739 1:48104878-48104900 GAATTGCTACCCATGGTGGAGGG + Intergenic
906741124 1:48186559-48186581 CAATTCTTCCCCTGGGGGGAGGG + Intergenic
907017557 1:51032118-51032140 CAATTTTTCCGCAGGGCGGGGGG + Intergenic
907385237 1:54121672-54121694 CTCTTTCTCTCCAGGGTGGCCGG + Intergenic
908326401 1:63028097-63028119 CAGTTTCTCCACATGGTGGGAGG - Intergenic
908429621 1:64043160-64043182 CCATCTCTCCTCAGGGAGGAAGG - Intronic
909766697 1:79365330-79365352 GAAGTTGTCTCCAGGGTGGATGG - Intergenic
910243655 1:85115680-85115702 TAATTTCTCCACTGGGTGGCAGG + Intronic
910253103 1:85219006-85219028 CAAATTCTCTCCATGTTGGAAGG - Intergenic
911164429 1:94712349-94712371 CAATTTTTCAACAGGTTGGAGGG - Intergenic
911250216 1:95568144-95568166 CAATTTTTCCACAGTGTGGGAGG + Intergenic
912285778 1:108366844-108366866 CACTTGCTCCCTGGGGTGGAGGG + Intergenic
913277390 1:117152388-117152410 CAATTTCGCCCCAGGAAGGATGG + Intronic
913552937 1:119934728-119934750 GAATTTCTCACCAGTGTGGATGG + Intronic
914340037 1:146752586-146752608 CAGCTTCTCCCCAGGGTTGCGGG - Intergenic
915249132 1:154576225-154576247 CCATCACTCCTCAGGGTGGATGG - Exonic
917903068 1:179562832-179562854 CAAATTCTCCCCAGAGATGAAGG + Intronic
917958388 1:180123723-180123745 CAATTGTGCCCAAGGGTGGAAGG - Intergenic
918595321 1:186286434-186286456 CAATTCCTCCCCAGGGTGGCAGG - Intergenic
922610828 1:226926112-226926134 CAATTTCTTCCCAGCATCGATGG + Intronic
922762914 1:228143518-228143540 CTGCTTCTCGCCAGGGTGGAAGG - Intronic
923057119 1:230435254-230435276 TAATTTATACCCAGGATGGAAGG + Intergenic
1062890943 10:1059340-1059362 CTCTGTCTCCCCAGGCTGGAGGG - Intronic
1063719410 10:8564697-8564719 CATCTTCTCCACAAGGTGGAAGG + Intergenic
1065273286 10:24059205-24059227 AAATTTATCCCTAGGGTGCAAGG - Intronic
1065741428 10:28800520-28800542 TAATTTCTCCCCTGGGTTGGAGG - Intergenic
1070848873 10:79546448-79546470 TCCTTTCTCCCCTGGGTGGAGGG + Intergenic
1070924918 10:80213742-80213764 TCCTTTCTCCCCTGGGTGGAGGG - Intergenic
1072238195 10:93471282-93471304 CAAACTCACCCCAGGGGGGATGG + Intronic
1074270069 10:111944972-111944994 TGATTTCTCCCTAGGATGGAGGG + Intergenic
1078422859 11:11226405-11226427 CACTTACTCCATAGGGTGGATGG - Intergenic
1078635974 11:13050590-13050612 TATTTTCTTCCTAGGGTGGAAGG + Intergenic
1078717576 11:13854592-13854614 CACATTCTGCCCAGGGTGGCAGG - Intergenic
1079319881 11:19442908-19442930 ACATTTCTCCCGATGGTGGAAGG - Intronic
1079518642 11:21298647-21298669 CAGTTTCTGCCCAGGGTCTATGG + Intronic
1080038441 11:27733530-27733552 CAATTGCTACTCTGGGTGGAGGG - Intergenic
1081059234 11:38452070-38452092 CATTTTCTCTTAAGGGTGGAAGG + Intergenic
1081194376 11:40143259-40143281 TAATTTCTCCACATAGTGGAGGG + Intronic
1082062273 11:47871199-47871221 CTATTTTTGCCCAGGCTGGAGGG + Intergenic
1082913370 11:58402924-58402946 AAATGTGTCCCCAGTGTGGATGG + Exonic
1083116634 11:60466185-60466207 GGATTTCTCTCCAGGGAGGAAGG + Intronic
1083727368 11:64635594-64635616 CAACTTCTCCCTGGGGTGGCAGG - Intronic
1083904783 11:65662634-65662656 CAGTTTCCCCTCTGGGTGGAGGG - Intronic
1085966013 11:81527432-81527454 CAATTCGTCCCCAGGATGCAAGG - Intergenic
1086345757 11:85894124-85894146 CAATTTTTCCCCAGACTGGGTGG - Intronic
1086422683 11:86652657-86652679 CAGTTTCTTCCTAGCGTGGATGG - Intronic
1087917143 11:103823893-103823915 CACTTTCTTCACAGGGTGGCAGG - Intergenic
1089290033 11:117431965-117431987 CACATTCTCCCCCAGGTGGAAGG - Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1091460589 12:641413-641435 ACTTTTCTCCCCAGGGTGAAAGG + Intronic
1092451022 12:8602107-8602129 TAATTTCTCACAAGGGTGTAAGG - Intergenic
1093736177 12:22623711-22623733 TGATTTCTCCCCAAAGTGGAAGG + Intergenic
1094531372 12:31278390-31278412 CAGTTTCTAACCAGGGTGTAAGG + Intergenic
1100086116 12:90913129-90913151 CAATTTCTTCACAAGGTGGCAGG + Intronic
1100391014 12:94146931-94146953 CAAGTTCTCCCCAGTGCTGAGGG - Intergenic
1102598936 12:114014060-114014082 CAACTGATCCCCAGGGGGGAAGG - Intergenic
1102875693 12:116447049-116447071 CAATTCCACCCCAGGATGGAAGG + Intergenic
1103597919 12:122035396-122035418 CAGTTCCTCCCCAGGGATGATGG + Exonic
1105511712 13:21057394-21057416 CAAAGTCTTCCCAGGGTGAACGG + Intronic
1106345459 13:28872554-28872576 CAGCTTCTCCACATGGTGGAAGG + Intronic
1106433357 13:29703292-29703314 CAAGTCCTGCCCAGGGTGGATGG - Intergenic
1107961276 13:45561640-45561662 CCATTTTTCCCCAGTGAGGAAGG + Intronic
1109227330 13:59712858-59712880 CAATTTTTCCACAGGGGTGAGGG + Intronic
1109717200 13:66232678-66232700 CACTTTCTTCACAGGGTGGCAGG + Intergenic
1112000434 13:95204535-95204557 CACTTTCTTCACAGGGTGGCAGG - Intronic
1113917059 13:113880783-113880805 GTATATCTCCCCAGGGTGGCGGG + Intergenic
1114634012 14:24177451-24177473 CCATTTCCCCTCAGGGTGGAAGG + Exonic
1116540777 14:46099471-46099493 CAGTTTCTTCCTAGGGTTGATGG + Intergenic
1117297704 14:54394248-54394270 CAAATTTTCCCCAGTGTGGAAGG - Intergenic
1118607442 14:67514532-67514554 CGCCTTCTCCCCAGGGTGCATGG - Intronic
1119810242 14:77511852-77511874 CACTTGCTCCCTAGGGAGGAGGG + Exonic
1121247404 14:92472000-92472022 CAGTTTCTCCCCAGGCAGGGAGG - Intronic
1122324623 14:100874958-100874980 CCCTTTGTGCCCAGGGTGGAGGG + Intergenic
1123202989 14:106684567-106684589 TAATTTATCTCCATGGTGGAAGG - Intergenic
1124649168 15:31462305-31462327 GAATTTCTACCCAGGGGAGATGG - Intergenic
1124842512 15:33256876-33256898 CAATTTTTCCACGGGGTGCAAGG + Intergenic
1126646918 15:50883848-50883870 CAATTTTTCCACAGACTGGAAGG - Intergenic
1127054247 15:55115618-55115640 CCCTCGCTCCCCAGGGTGGAGGG - Intergenic
1128668504 15:69556569-69556591 TAAATACTCCCCAGGGTGGATGG + Intergenic
1131077124 15:89502382-89502404 CAGTTTCTCCCCTGGGTGGCCGG + Intergenic
1132159812 15:99529714-99529736 CAACTTCTTCACAGGGTGGCAGG - Intergenic
1133458944 16:5969836-5969858 CAATATCTTCTCAGTGTGGATGG + Intergenic
1133470481 16:6070202-6070224 CAAAATCTCCCCAGGGATGATGG - Intronic
1134021498 16:10924213-10924235 TACTTTCTCCCCAGGGTGGCAGG - Exonic
1134125805 16:11615200-11615222 CATTTACACCCCAGGGTAGATGG - Intronic
1138393832 16:56689590-56689612 CAATTGCTCCCCAGTGTTGCAGG - Intronic
1138850537 16:60623626-60623648 CACTCTGTCCCCAGGCTGGATGG - Intergenic
1139128141 16:64106923-64106945 CAATTTCTCACCATGCTGCAGGG + Intergenic
1139243525 16:65418744-65418766 CAATGTCTCCACAAAGTGGAAGG + Intergenic
1139304546 16:65973318-65973340 GAATTTATCCCCAGGATGCAAGG - Intergenic
1139994251 16:70964822-70964844 CAGCTTCTCCCCAGGGTTGCGGG + Exonic
1141494926 16:84402620-84402642 GAATTTATCCCAAGGGTGCAAGG - Intronic
1144461956 17:15465819-15465841 CATGTCCTCCCCACGGTGGATGG - Intronic
1145887609 17:28393515-28393537 CACTTTTTGCCCAGGCTGGAGGG - Intronic
1147414511 17:40278816-40278838 CAATTTATCCCTGGGGTGGTGGG - Exonic
1148087169 17:45001211-45001233 CCCTGTCTCCCCAGGGTGGGAGG - Intergenic
1148126741 17:45241301-45241323 CATCTTCTTCCCGGGGTGGAGGG - Intronic
1149131546 17:53307528-53307550 TGATTTATCCCCAGGGTGCAGGG + Intergenic
1149500326 17:57147573-57147595 CATTTTCCCCCCAGGGTACAGGG - Intergenic
1150143902 17:62752257-62752279 GAATGTCTCCCCTGAGTGGATGG - Intronic
1151191272 17:72399808-72399830 CTATTTACCCCCAGGGTGGCTGG - Intergenic
1151295117 17:73179615-73179637 GCATTTCATCCCAGGGTGGATGG + Intergenic
1151972557 17:77466346-77466368 TAATTTCTCCCAAGGCTGGGAGG - Intronic
1154071202 18:11153022-11153044 CACATTCTCCACAGGCTGGATGG - Intergenic
1156660318 18:39338888-39338910 CAATTGCTCCCTAGAGTGAATGG + Intergenic
1157217550 18:45798144-45798166 CAATTTCTTCCTAGGCTTGACGG + Intergenic
1157438605 18:47692382-47692404 CAACTTGTCCCCAGGTTGGCTGG - Intergenic
1157691610 18:49687039-49687061 CAATTTTTCCCCTGGGTGAAGGG + Intergenic
1158885377 18:61821910-61821932 CAATTTTTCCACAGGACGGATGG - Intronic
1158956318 18:62543138-62543160 CCTTTTCTCCTCAGGTTGGATGG + Intronic
1161320180 19:3637499-3637521 CCCCTTCTCCCCAGGGTGGCCGG + Intronic
1161492553 19:4570230-4570252 CAAGTTATTCCCAGGGTGGGAGG - Intergenic
1161977399 19:7613963-7613985 AAAGTCCTCCCCAGGGTGGCCGG + Intronic
1162408367 19:10489584-10489606 CAGTTTCACCCCAGGATGGTAGG + Intronic
1162462222 19:10819966-10819988 CTCTTTCTCCTGAGGGTGGAGGG - Exonic
1163434398 19:17286568-17286590 ACATTTCTCCCCAGGCTGGATGG - Exonic
1163808537 19:19415649-19415671 CACTTTGTCACCAGGCTGGAGGG + Intronic
1164946619 19:32299567-32299589 GAATTTATCCCCAGGATGCAAGG - Intergenic
1166676263 19:44742840-44742862 CCATTTCTTCCCAGGGAGAAGGG + Intergenic
1167118135 19:47500163-47500185 TAATTCCTCCCCAGGATGTAGGG + Intronic
1167674384 19:50875413-50875435 CTGTGTCTCCCCAGGGTGGAGGG - Intronic
1167802479 19:51753634-51753656 CAATTTCTCCATGGGGTGGCGGG - Intronic
925146340 2:1585659-1585681 CACGTGCTCCCCAGGGTGGAGGG - Intergenic
926504800 2:13700163-13700185 CACTTTCTTCCCAAGGTGGAAGG - Intergenic
926576882 2:14592400-14592422 CACTATCTTCCCATGGTGGAAGG - Intergenic
928062954 2:28133534-28133556 TAATTTTTACCCAGTGTGGATGG - Intronic
928398410 2:30960743-30960765 CCATTCCCTCCCAGGGTGGAGGG - Intronic
928697444 2:33863528-33863550 CAAACCCTCCACAGGGTGGAAGG + Intergenic
929434166 2:41914629-41914651 CAATTTCTTCACAAGGTGGCAGG - Intergenic
931249193 2:60515240-60515262 CACTTTCTCCCCAGGGAGGAAGG + Intronic
932385479 2:71328363-71328385 CAATTTCTCCCCAGCCAGAAAGG + Intronic
934318709 2:91951137-91951159 CAGTTTCTTCCTAGGATGGATGG - Intergenic
934958306 2:98643894-98643916 TAATTCCTCACCAGAGTGGAGGG - Intronic
935943920 2:108269273-108269295 CAATGTGCCCCCTGGGTGGAAGG - Intergenic
936249381 2:110855875-110855897 CAAAGTTTCCACAGGGTGGAAGG + Intronic
936346555 2:111679988-111680010 CCATTGCTGCCCAGGGTGCAGGG - Intergenic
938157892 2:128957126-128957148 GAAGTACTCCCCAGGGAGGAGGG + Intergenic
945013358 2:205488246-205488268 CAATTTTTCCACAGGGCGGGGGG + Intronic
1169140991 20:3227543-3227565 CAGCTTCTGCCCAGGGTGGGTGG - Exonic
1170336955 20:15281018-15281040 CACTTTCTTCACAGGGTGGCAGG + Intronic
1171515054 20:25723815-25723837 TAATTTATCCCAAGGGCGGAAGG - Intergenic
1171793454 20:29548518-29548540 CACTTTCTCCCCAGAGCTGAGGG + Intergenic
1171855006 20:30335861-30335883 CACTTTCTCCCCAGAGCTGAGGG - Intergenic
1172897709 20:38312201-38312223 CATTTTCTCAGCAGGGAGGAAGG - Intronic
1173095590 20:40025079-40025101 CAATTTTTCCACAGTGTGGGGGG + Intergenic
1173537315 20:43825469-43825491 CTATCACTCCCCAGGATGGAGGG - Intergenic
1173945418 20:46946378-46946400 CAAAATCTCCCCAGGGTGCAGGG + Intronic
1174391354 20:50220194-50220216 CAAGGGCTCCCCAGGGAGGAAGG - Intergenic
1174435375 20:50502841-50502863 CAAATTCTCCCCTGGGCAGAGGG + Intergenic
1174934163 20:54849504-54849526 AAATGTATCCCCAGTGTGGAGGG + Intergenic
1177183461 21:17768161-17768183 CAATCTCTCTAGAGGGTGGAAGG + Intergenic
1177338446 21:19763795-19763817 CAATGTCCCCACATGGTGGAAGG - Intergenic
1177394222 21:20511890-20511912 CACTTTCTTCACAGGGTGGCAGG + Intergenic
1177719300 21:24883772-24883794 CACCTTCTCCACAGGGTGGCAGG - Intergenic
1181440282 22:22932106-22932128 CTCCTTCTCCCCAGGGTGGGAGG + Intergenic
1181880283 22:25973782-25973804 AGACTTCTCCCTAGGGTGGAGGG + Intronic
1184506777 22:44908437-44908459 ATATTTCTCCCCATGGTGCATGG + Intronic
1184668473 22:46000823-46000845 CATCATCTGCCCAGGGTGGAAGG - Intergenic
949191397 3:1253592-1253614 CAATTTTTCCCCAGGATGAGGGG + Intronic
949484285 3:4522813-4522835 CAATCTCTTCCTAGGGAGGAGGG - Intronic
950160141 3:10754286-10754308 CAAGTTCTCAACAGAGTGGAAGG - Intergenic
950735933 3:15008088-15008110 CAAGTTCTCCCCATGGTGCCAGG - Intronic
951753328 3:26061306-26061328 CATTTTCTCCACATGGTGGCTGG + Intergenic
953871983 3:46634761-46634783 TATTTTCTCCCCAGTGTTGAAGG + Intergenic
953961017 3:47265696-47265718 CAGTTGCTGCCCAGGGAGGAGGG - Intronic
954919874 3:54180835-54180857 CAAAAGCTGCCCAGGGTGGAAGG - Intronic
955855136 3:63264793-63264815 CACTTTCCTCACAGGGTGGAAGG + Intronic
956392044 3:68784668-68784690 CAAAGTTTCCACAGGGTGGAAGG + Intronic
956525564 3:70155788-70155810 CAGTTTCTGCTTAGGGTGGAGGG + Intergenic
960814842 3:121661804-121661826 CAATTCCCCCACATGGTGGATGG - Intergenic
960819026 3:121707191-121707213 CACTTTGTCACCAGGCTGGAGGG - Intronic
961555613 3:127694933-127694955 CCACTTCCCCCCAAGGTGGAGGG - Intronic
963533779 3:146502830-146502852 AAATTTCTACTCATGGTGGAAGG - Intergenic
964633648 3:158838433-158838455 CCAACTTTCCCCAGGGTGGAGGG + Intergenic
965364748 3:167784606-167784628 CAACTTCTTCACAGGGTGGCAGG + Intronic
967952781 3:194853546-194853568 CAATTCCTCCCCAGGGCAGAGGG + Intergenic
969256189 4:6003201-6003223 CAACATGTCCCTAGGGTGGATGG - Intergenic
969676756 4:8618642-8618664 CCATTCCTCCCCAGGCTGGCTGG + Intronic
970886426 4:20992256-20992278 CACTTTCTTCACAGGGTGGCAGG + Intronic
971121760 4:23712348-23712370 CAATTTTTCCACAGATTGGAGGG - Intergenic
971129927 4:23796457-23796479 CAAATTCTCCCCAAATTGGAAGG + Intronic
971905077 4:32715945-32715967 CAAAGCCTCCACAGGGTGGAAGG + Intergenic
973258693 4:48138858-48138880 CACTTTCTCCTCAGGGCGGACGG + Intronic
973798608 4:54453232-54453254 CAGTTTCTCCACAGTGTTGATGG - Intergenic
979778508 4:124620197-124620219 CAATTTCCCCTCAGGGTGTTTGG + Intergenic
980038225 4:127909289-127909311 CACATTCTCCACAGGCTGGATGG + Intergenic
980325384 4:131338235-131338257 CACCTTCTTCCCAGGGTGGCAGG - Intergenic
980659381 4:135837588-135837610 ATAATTCTCCCTAGGGTGGAGGG - Intergenic
981207370 4:142059225-142059247 CAATGTCTCCTGTGGGTGGAGGG + Intronic
981905533 4:149917453-149917475 CAATTTCTTCCTAGTGTCGATGG - Intergenic
986796164 5:11214418-11214440 CAATTTTTCTCCAGACTGGAAGG + Intronic
988042989 5:25911876-25911898 CAATTTCTCCCCAGGGTGGATGG + Intergenic
988050837 5:26029447-26029469 CTCTGTCTCCCCAGGCTGGAGGG + Intergenic
992244258 5:74802327-74802349 CACTTTGTCATCAGGGTGGAGGG - Intronic
993305829 5:86273574-86273596 CACTTGCTCCCTGGGGTGGAGGG + Intergenic
994164968 5:96598760-96598782 CATTCCCTCCCCAGTGTGGATGG + Intronic
994683886 5:102924883-102924905 AAATTGCTCCCCATGGTGGGAGG - Intronic
994835963 5:104852674-104852696 CAGTTTCTTCACAGTGTGGATGG + Intergenic
994873278 5:105380803-105380825 CACTTTCTTCACAGGGTGGCAGG - Intergenic
995413921 5:111888397-111888419 CAACTTCTTCACAGGGTGGCAGG + Intronic
996070563 5:119126247-119126269 CTCTTGCTGCCCAGGGTGGAGGG - Intronic
998207700 5:140170744-140170766 CAATTTCTCCCCCGAGTAGCTGG - Intergenic
998805907 5:145917811-145917833 CACTTTGTCACCAGGCTGGAGGG + Intergenic
998959171 5:147466561-147466583 CAATTTCACCCTTGGGTGAATGG + Intronic
999257046 5:150215589-150215611 CTCTTTCTCCCCAGGCTGGTTGG - Intronic
999663760 5:153892002-153892024 CAATTTCCCCCCTTGGTGAAAGG - Intergenic
999825672 5:155271474-155271496 CAATTTCTCCCCAGGACTGGGGG + Intergenic
1001795167 5:174496044-174496066 CAATGGCACCCCAGGGTGAAAGG - Intergenic
1001937173 5:175713754-175713776 CAATTTCTTCCCAGTGTTGCTGG - Intergenic
1003329796 6:5120529-5120551 CAAAGTCTCCACAGCGTGGAAGG + Intronic
1003487673 6:6593749-6593771 GAATTTCTCCCCAGAGTAGATGG + Intronic
1003995762 6:11538053-11538075 CAATGTCTCCCCGGCGGGGAGGG + Intergenic
1004427051 6:15513675-15513697 CACCTGCTCCCCAGGGAGGAAGG - Intronic
1004911780 6:20292742-20292764 CAATTTTTCCCCAGATGGGACGG + Intergenic
1004973800 6:20942399-20942421 CTATTTTTGCCCAGGTTGGAGGG + Intronic
1005135510 6:22565919-22565941 GAATTTCTACCCATGGTGGAGGG + Intergenic
1005810706 6:29513533-29513555 CAATTGCTCTGCAGGGTGGAAGG - Intergenic
1008024480 6:46618792-46618814 CAATCTCTCCCCAGCCAGGAAGG - Intronic
1010805718 6:80233935-80233957 CAATTTTTCCACAGACTGGAGGG + Intronic
1012171089 6:96016692-96016714 CTATTCCTTCCCAGGGTGAATGG + Intronic
1014378996 6:120715155-120715177 CAACTTCTTCACAGGGTGGCAGG + Intergenic
1014837058 6:126171619-126171641 CAATTTGTCACAAGAGTGGAGGG + Intergenic
1014942482 6:127459174-127459196 GGATTTCTCCCCAGTGTGAAAGG - Exonic
1016491649 6:144611021-144611043 GGATTTATCCCCAGGATGGAAGG + Intronic
1016578577 6:145600969-145600991 GAATCTCTCCCCAGGTTGGGGGG + Intronic
1018539631 6:164864346-164864368 CACTTTCTTCACAGGGTGGCAGG + Intergenic
1019973022 7:4557508-4557530 CAATTTCTCCCCAGAGGGGCTGG - Intergenic
1019980510 7:4618268-4618290 CACCTTCTTCCCAGGGTGGCAGG - Intergenic
1021179764 7:17492497-17492519 CCATTTGTCCCCAAGCTGGATGG + Intergenic
1022013751 7:26330661-26330683 CAATGTCTGCCCAGGCTGAAGGG - Intronic
1022506813 7:30912656-30912678 CAAAGTTTCCCCAGGGTGCAGGG - Intronic
1022612486 7:31890929-31890951 CATTTCCTCCCCAGTGTGGTGGG - Intronic
1026563784 7:71472650-71472672 CACTCTGTCCCCAGGCTGGAGGG - Intronic
1026953720 7:74364006-74364028 CCCTTCCTCCCCAGGGTGGTGGG - Intronic
1028409260 7:90510144-90510166 CAATATCTGCCCTGTGTGGAAGG + Intronic
1028649666 7:93137616-93137638 CAATTTTTCCACAGGGTAGTGGG - Intronic
1029129620 7:98319991-98320013 CGAGTTCTCCCCAGGCTGGGAGG + Intronic
1030806261 7:113923219-113923241 CACTTTGTCTCCAGGCTGGAGGG - Intronic
1034236741 7:149577882-149577904 CAATTTCTTCCCAGCATCGATGG + Intergenic
1034706775 7:153152649-153152671 CAGATTCTCCCCAGGGCTGAAGG - Intergenic
1038060085 8:23902940-23902962 CAAATACTCCCCAGGACGGAGGG - Intergenic
1039579809 8:38655641-38655663 CAATTTCCCTCCAGGGAGCAGGG + Intergenic
1041071385 8:54128981-54129003 CAATCTCTCCTCACGCTGGATGG - Intergenic
1041722688 8:60990456-60990478 CTCTTCTTCCCCAGGGTGGATGG + Intergenic
1042063180 8:64843698-64843720 CAGTTTCATCCCATGGTGGATGG - Intergenic
1042528661 8:69793009-69793031 CACTCTCTGCCCAGGCTGGATGG + Intronic
1045180891 8:99781064-99781086 TCATTTTTCCCCAGTGTGGATGG + Intronic
1045667915 8:104511071-104511093 CACTCTGTCTCCAGGGTGGATGG + Intronic
1046017288 8:108620386-108620408 CTATTTCTCCGTGGGGTGGAGGG + Intronic
1046309567 8:112416302-112416324 CACTTTCTTCACAGGGTGGCAGG - Intronic
1047140205 8:122130058-122130080 CACTCTGTCCCCAGGCTGGAGGG + Intergenic
1047351648 8:124079998-124080020 CAATTTCTTTCCAGTGGGGAAGG - Intronic
1047362486 8:124182002-124182024 TAATTTCTGCCCAGGGTTCACGG + Intergenic
1048049766 8:130806030-130806052 GCATTTCCCCACAGGGTGGACGG + Intronic
1048729639 8:137424530-137424552 TAATATCTTCCAAGGGTGGAAGG + Intergenic
1050500311 9:6291127-6291149 CAGTTCCTGCTCAGGGTGGATGG - Intergenic
1051174400 9:14348096-14348118 CATTTCCTTCCCAGGGTGCAGGG - Intronic
1051480086 9:17550230-17550252 CAATGTCCTCACAGGGTGGAAGG + Intergenic
1051697987 9:19789208-19789230 AGATTTCTCCGCAGTGTGGACGG + Intergenic
1051756740 9:20408947-20408969 GCATTTTTCCCAAGGGTGGATGG - Intronic
1052276539 9:26683103-26683125 CAATTTCGCCCCTGAGTGGCTGG + Intergenic
1052327879 9:27235953-27235975 CAATTTATCCCTAGGTTGCAAGG + Intergenic
1052756993 9:32551461-32551483 CTGTTTCTCCCCAGCCTGGAGGG - Intronic
1053792834 9:41699150-41699172 CACTTTCTCCCCAGAGCTGAGGG - Intergenic
1054152340 9:61615675-61615697 CACTTTCTCCCCAGAGCTGAGGG + Intergenic
1054181247 9:61911171-61911193 CACTTTCTCCCCAGAGCTGAGGG - Intergenic
1054472115 9:65546818-65546840 CACTTTCTCCCCAGAGCTGAGGG + Intergenic
1054656346 9:67669971-67669993 CACTTTCTCCCCAGAGCTGAGGG + Intergenic
1056563712 9:87755643-87755665 CACTTTTTCCCAAGGGTGGCCGG - Intergenic
1059496114 9:114710806-114710828 ACATTTCTCCCCTGGGTGTAAGG + Intergenic
1059755479 9:117289422-117289444 GACTTTCTCCCCAGGATGGTAGG - Intronic
1060281582 9:122219049-122219071 CGAATGCTCCCCCGGGTGGAGGG - Intronic
1060962849 9:127693404-127693426 GAACTTCTCTCCAGGATGGAAGG + Intronic
1061377931 9:130237015-130237037 CAATTTCTCCCCCAAGTGGCAGG - Exonic
1186260069 X:7768099-7768121 CCAGATATCCCCAGGGTGGAGGG + Intergenic
1187574632 X:20541441-20541463 CACTTTCTTCACAGGGTGGCAGG - Intergenic
1191870395 X:65740526-65740548 CAATTTCTCCCCAGGGTGGATGG + Exonic
1193086007 X:77448187-77448209 CAGTATCTCCCCAGGGAGCAAGG + Intronic
1194329019 X:92557939-92557961 CACTTTCTTCACAGGGTGGCTGG + Intronic
1198437165 X:136628516-136628538 CAATTTCAGCTCAGTGTGGATGG + Intergenic
1200150500 X:153949071-153949093 AAGTCTCTCCCCAGGGTGGGCGG + Exonic
1200637727 Y:5677140-5677162 CACTTTCTTCACAGGGTGGCTGG + Intronic