ID: 1191870643

View in Genome Browser
Species Human (GRCh38)
Location X:65742221-65742243
Sequence TCCTGGACTTGCCTGGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191870633_1191870643 29 Left 1191870633 X:65742169-65742191 CCAGGCCAACTTTTCTACTGTGG No data
Right 1191870643 X:65742221-65742243 TCCTGGACTTGCCTGGCATTGGG No data
1191870638_1191870643 -2 Left 1191870638 X:65742200-65742222 CCTGCATTGACCATGTGATGCTC No data
Right 1191870643 X:65742221-65742243 TCCTGGACTTGCCTGGCATTGGG No data
1191870636_1191870643 24 Left 1191870636 X:65742174-65742196 CCAACTTTTCTACTGTGGGTGTG No data
Right 1191870643 X:65742221-65742243 TCCTGGACTTGCCTGGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191870643 Original CRISPR TCCTGGACTTGCCTGGCATT GGG Intergenic
No off target data available for this crispr