ID: 1191873616

View in Genome Browser
Species Human (GRCh38)
Location X:65771847-65771869
Sequence ATGCTAATATTTGTGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191873616_1191873625 26 Left 1191873616 X:65771847-65771869 CCTCTTTCCACAAATATTAGCAT No data
Right 1191873625 X:65771896-65771918 GACAGAGCCATAAAGGGCTGAGG No data
1191873616_1191873620 -6 Left 1191873616 X:65771847-65771869 CCTCTTTCCACAAATATTAGCAT No data
Right 1191873620 X:65771864-65771886 TAGCATAACCAACAAAATAGGGG No data
1191873616_1191873623 19 Left 1191873616 X:65771847-65771869 CCTCTTTCCACAAATATTAGCAT No data
Right 1191873623 X:65771889-65771911 ATAGTAAGACAGAGCCATAAAGG No data
1191873616_1191873618 -8 Left 1191873616 X:65771847-65771869 CCTCTTTCCACAAATATTAGCAT No data
Right 1191873618 X:65771862-65771884 ATTAGCATAACCAACAAAATAGG No data
1191873616_1191873621 -5 Left 1191873616 X:65771847-65771869 CCTCTTTCCACAAATATTAGCAT No data
Right 1191873621 X:65771865-65771887 AGCATAACCAACAAAATAGGGGG No data
1191873616_1191873624 20 Left 1191873616 X:65771847-65771869 CCTCTTTCCACAAATATTAGCAT No data
Right 1191873624 X:65771890-65771912 TAGTAAGACAGAGCCATAAAGGG No data
1191873616_1191873619 -7 Left 1191873616 X:65771847-65771869 CCTCTTTCCACAAATATTAGCAT No data
Right 1191873619 X:65771863-65771885 TTAGCATAACCAACAAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191873616 Original CRISPR ATGCTAATATTTGTGGAAAG AGG (reversed) Intergenic