ID: 1191873617 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:65771854-65771876 |
| Sequence | GTTGGTTATGCTAATATTTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1191873617_1191873623 | 12 | Left | 1191873617 | X:65771854-65771876 | CCACAAATATTAGCATAACCAAC | No data | ||
| Right | 1191873623 | X:65771889-65771911 | ATAGTAAGACAGAGCCATAAAGG | 0: 1 1: 0 2: 2 3: 13 4: 176 |
||||
| 1191873617_1191873624 | 13 | Left | 1191873617 | X:65771854-65771876 | CCACAAATATTAGCATAACCAAC | No data | ||
| Right | 1191873624 | X:65771890-65771912 | TAGTAAGACAGAGCCATAAAGGG | No data | ||||
| 1191873617_1191873625 | 19 | Left | 1191873617 | X:65771854-65771876 | CCACAAATATTAGCATAACCAAC | No data | ||
| Right | 1191873625 | X:65771896-65771918 | GACAGAGCCATAAAGGGCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1191873617 | Original CRISPR | GTTGGTTATGCTAATATTTG TGG (reversed) | Intergenic | ||