ID: 1191873617

View in Genome Browser
Species Human (GRCh38)
Location X:65771854-65771876
Sequence GTTGGTTATGCTAATATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191873617_1191873623 12 Left 1191873617 X:65771854-65771876 CCACAAATATTAGCATAACCAAC No data
Right 1191873623 X:65771889-65771911 ATAGTAAGACAGAGCCATAAAGG No data
1191873617_1191873624 13 Left 1191873617 X:65771854-65771876 CCACAAATATTAGCATAACCAAC No data
Right 1191873624 X:65771890-65771912 TAGTAAGACAGAGCCATAAAGGG No data
1191873617_1191873625 19 Left 1191873617 X:65771854-65771876 CCACAAATATTAGCATAACCAAC No data
Right 1191873625 X:65771896-65771918 GACAGAGCCATAAAGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191873617 Original CRISPR GTTGGTTATGCTAATATTTG TGG (reversed) Intergenic