ID: 1191873622

View in Genome Browser
Species Human (GRCh38)
Location X:65771872-65771894
Sequence TACTATGCCCCCTATTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191873622_1191873624 -5 Left 1191873622 X:65771872-65771894 CCAACAAAATAGGGGGCATAGTA No data
Right 1191873624 X:65771890-65771912 TAGTAAGACAGAGCCATAAAGGG No data
1191873622_1191873623 -6 Left 1191873622 X:65771872-65771894 CCAACAAAATAGGGGGCATAGTA No data
Right 1191873623 X:65771889-65771911 ATAGTAAGACAGAGCCATAAAGG 0: 1
1: 0
2: 2
3: 13
4: 176
1191873622_1191873625 1 Left 1191873622 X:65771872-65771894 CCAACAAAATAGGGGGCATAGTA No data
Right 1191873625 X:65771896-65771918 GACAGAGCCATAAAGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191873622 Original CRISPR TACTATGCCCCCTATTTTGT TGG (reversed) Intergenic