ID: 1191873624

View in Genome Browser
Species Human (GRCh38)
Location X:65771890-65771912
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191873617_1191873624 13 Left 1191873617 X:65771854-65771876 CCACAAATATTAGCATAACCAAC No data
Right 1191873624 X:65771890-65771912 TAGTAAGACAGAGCCATAAAGGG No data
1191873616_1191873624 20 Left 1191873616 X:65771847-65771869 CCTCTTTCCACAAATATTAGCAT No data
Right 1191873624 X:65771890-65771912 TAGTAAGACAGAGCCATAAAGGG No data
1191873622_1191873624 -5 Left 1191873622 X:65771872-65771894 CCAACAAAATAGGGGGCATAGTA No data
Right 1191873624 X:65771890-65771912 TAGTAAGACAGAGCCATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191873624 Original CRISPR TAGTAAGACAGAGCCATAAA GGG Intergenic