ID: 1191873625

View in Genome Browser
Species Human (GRCh38)
Location X:65771896-65771918
Sequence GACAGAGCCATAAAGGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191873622_1191873625 1 Left 1191873622 X:65771872-65771894 CCAACAAAATAGGGGGCATAGTA No data
Right 1191873625 X:65771896-65771918 GACAGAGCCATAAAGGGCTGAGG No data
1191873616_1191873625 26 Left 1191873616 X:65771847-65771869 CCTCTTTCCACAAATATTAGCAT No data
Right 1191873625 X:65771896-65771918 GACAGAGCCATAAAGGGCTGAGG No data
1191873617_1191873625 19 Left 1191873617 X:65771854-65771876 CCACAAATATTAGCATAACCAAC No data
Right 1191873625 X:65771896-65771918 GACAGAGCCATAAAGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191873625 Original CRISPR GACAGAGCCATAAAGGGCTG AGG Intergenic
No off target data available for this crispr