ID: 1191873820

View in Genome Browser
Species Human (GRCh38)
Location X:65773445-65773467
Sequence CTGAATAAGCAGATCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 4, 1: 2, 2: 2, 3: 12, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191873815_1191873820 9 Left 1191873815 X:65773413-65773435 CCTTTGGGACTGGTGGAAGAATC No data
Right 1191873820 X:65773445-65773467 CTGAATAAGCAGATCCATGGAGG 0: 4
1: 2
2: 2
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191873820 Original CRISPR CTGAATAAGCAGATCCATGG AGG Intergenic
901104301 1:6743419-6743441 CTGATTAAGCTGATCTAGGGTGG - Intergenic
903756122 1:25662244-25662266 TTGAATAAGCAAATGCAGGGAGG + Intronic
906513228 1:46423426-46423448 CCGCATAAGCAGACGCATGGAGG - Intergenic
908736204 1:67279396-67279418 ATGGAAAAGCAGATCCATGCTGG - Intergenic
910438713 1:87230982-87231004 CTGAAAAAGGAAATGCATGGCGG - Intergenic
912125630 1:106533940-106533962 ATGAATAAACAGATCCAGAGAGG + Intergenic
912957458 1:114165571-114165593 CTGAGTAGGCATCTCCATGGTGG + Intergenic
919647787 1:200113148-200113170 CTGAATGAGGAACTCCATGGTGG + Intronic
920043656 1:203119962-203119984 CTGAATAGGCAAATCCATGGAGG + Intronic
921090590 1:211838426-211838448 CTGATTCAGGAGATCCAGGGTGG - Intergenic
922341587 1:224660845-224660867 ATGGAAAAGCAGATCCATGCTGG + Intronic
922568976 1:226621387-226621409 CAGAATAAGCAAATCCATAGAGG - Intergenic
1067196533 10:44124408-44124430 CTGAATAAGTAAATAAATGGGGG - Intergenic
1067664770 10:48267934-48267956 CAGAATAAACAAATCCATAGAGG + Intronic
1070826950 10:79396649-79396671 CTGATTCTGCAGATCCAAGGTGG - Intronic
1072230707 10:93411894-93411916 CTGAAAAAGCAGATCGGGGGAGG - Intronic
1072733071 10:97861091-97861113 CGGATTCAGCAGATCCAGGGAGG - Intronic
1072943572 10:99789223-99789245 CTGAATAAATAGATCCACGGAGG + Intronic
1074878317 10:117631842-117631864 CTGGATAGGCAGGTCCAAGGGGG + Intergenic
1075839919 10:125492738-125492760 CTGAATAAAGAGATCAAAGGAGG + Intergenic
1080185323 11:29476536-29476558 ATGAATAAACAGATTCATAGTGG - Intergenic
1080898285 11:36463764-36463786 CAGGATAAAGAGATCCATGGTGG + Exonic
1081550592 11:44108176-44108198 CTGGTTAAGCACATCGATGGAGG - Exonic
1084532525 11:69736611-69736633 GTGGAAAAGCAGATCCATGCTGG + Intergenic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1085655578 11:78311690-78311712 ATGAATAAACAAATGCATGGAGG - Intronic
1088560070 11:111105707-111105729 CTGAAGAAGCAGATTCACAGGGG - Intergenic
1089717841 11:120380800-120380822 CTGAATAAACAGATAAATGTGGG - Intronic
1092355665 12:7792965-7792987 CTGAATAAGCAGATCCATGGAGG - Exonic
1092368320 12:7895492-7895514 CTGAATAGGCAGATCCATGGAGG - Intergenic
1097280143 12:57840202-57840224 CTGATTCAGCAGATCCCAGGTGG + Intronic
1097611334 12:61825048-61825070 CTCAATAACCAGATACATGGAGG + Intronic
1099829025 12:87816159-87816181 CTGAGTATGCTGATCCATGGAGG - Intergenic
1099834207 12:87886783-87886805 TTGAATAAGCAGAAACTTGGAGG + Intergenic
1100017477 12:90028281-90028303 CTGAGTATGAAGATCCATGTGGG + Intergenic
1100434977 12:94562833-94562855 TTGACTAAGAAAATCCATGGAGG - Intergenic
1100808943 12:98318201-98318223 CTGAAAAAGAAGATACATAGTGG + Intergenic
1106434200 13:29709238-29709260 CAGAATAAGCAAATCCATAGAGG - Intergenic
1108101577 13:46962461-46962483 ATGCAGAAGCTGATCCATGGTGG + Intergenic
1109280800 13:60352679-60352701 CAGAATAGGCAAATCCATAGAGG - Intergenic
1110276530 13:73647481-73647503 CAGAATAGGCAAATCCATAGAGG + Intergenic
1112489847 13:99852120-99852142 CAGAATAAGCAAATCTATAGAGG + Intronic
1113411298 13:110092633-110092655 GTGCAAAAGCAGATCCATGGAGG - Intergenic
1116295042 14:43096972-43096994 GTGAATAAGCAGATGCAGTGTGG + Intergenic
1116554831 14:46289829-46289851 CTGAATAAGTAGATCTATAAAGG + Intergenic
1117249463 14:53921962-53921984 AAGAATAATCAGATACATGGTGG - Intergenic
1117540050 14:56738242-56738264 GTGAATAAACACATTCATGGAGG + Intergenic
1119639873 14:76306530-76306552 CAGAATAGGCAAATCCATAGAGG + Intergenic
1121148215 14:91605131-91605153 CTAAATAAGCAGATCCACGGAGG + Intronic
1121414224 14:93767883-93767905 CAGAACAGGCAAATCCATGGAGG + Intronic
1122101520 14:99414140-99414162 ATGAAGAAGCAGATTTATGGCGG - Intronic
1122513409 14:102288475-102288497 CAGAATAAGCAAATCTATAGAGG + Intronic
1125032300 15:35084922-35084944 CTGAATAAGCAGATCCATGGAGG + Intergenic
1127903377 15:63357870-63357892 CGGAAGAGGCAAATCCATGGAGG - Intronic
1129181673 15:73881832-73881854 CGGAATAAGAAGTTGCATGGGGG - Intronic
1129383987 15:75185660-75185682 CAGAATAAGCAGATGCCTTGGGG - Intergenic
1131535894 15:93237714-93237736 ATGTAAAAGCAGTTCCATGGGGG - Intergenic
1134512188 16:14857304-14857326 CTGAATAACCAAATCAAAGGTGG + Exonic
1134699824 16:16255807-16255829 CTGAATAACCAAATCAAAGGTGG + Exonic
1134972001 16:18538855-18538877 CTGAATAACCAAATCAAAGGTGG - Exonic
1135570711 16:23547288-23547310 CAGAAGAGGCAAATCCATGGAGG + Intronic
1137775247 16:51048732-51048754 GTGAGTCAGCAGATCCATGAAGG - Intergenic
1141358029 16:83367174-83367196 CAGAATGGGCAAATCCATGGAGG - Intronic
1145211243 17:21014937-21014959 CTGATTCAGCAGATCTGTGGGGG - Intronic
1146500800 17:33362827-33362849 CTGAATAAGCAAATGAATGGAGG + Intronic
1146662827 17:34675966-34675988 CTGAATGTGCAGGGCCATGGAGG + Intergenic
1146998288 17:37340464-37340486 CTGATTCAGCAGATCTAGGGTGG - Intronic
1147899425 17:43774305-43774327 TTGATTCAGCAGCTCCATGGTGG - Intronic
1148908270 17:50925519-50925541 CTGATTCAGCAGATCTAAGGTGG + Intergenic
1149604247 17:57913732-57913754 GTGAATCAGCAGGTCCCTGGAGG - Intronic
1149687759 17:58547191-58547213 CTGACTAAGTAGGTCCAAGGTGG - Intergenic
1150186126 17:63183190-63183212 ATGGAAAAGCAGATCCATGCTGG - Intronic
1151402770 17:73866767-73866789 CTGAATCAGCAGTTCCACGAGGG + Intergenic
1152513007 17:80803082-80803104 CAGGATAAACAGATCCAAGGAGG - Intronic
1155576765 18:27256073-27256095 CAGAACAGGCAAATCCATGGAGG - Intergenic
1156822364 18:41388432-41388454 ATGAGTAAGTAGATCCAGGGAGG + Intergenic
1156833890 18:41529310-41529332 CTGAATTAACAGATCCAGTGTGG + Intergenic
1156954071 18:42940096-42940118 CTGCATAAACAAATGCATGGGGG - Intronic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1159055150 18:63455884-63455906 CAGAACAAGCAAATCTATGGAGG - Intergenic
1164063592 19:21695429-21695451 GTGCATGAGCAGAGCCATGGAGG + Intergenic
1164729877 19:30495489-30495511 CTGAACAAGCAGAGGCATGCTGG + Intronic
1167553951 19:50181047-50181069 CTGATTCAGCAGGTCCAGGGTGG - Intergenic
926313617 2:11693462-11693484 CTGATTCAGCAGGTCCAAGGTGG - Intronic
927285978 2:21357082-21357104 CTGAATCAGCAGGTCTAGGGTGG - Intergenic
927688863 2:25193319-25193341 CAGAATAGGCAGATCTATAGAGG + Intergenic
929968390 2:46552474-46552496 CTGAATAAGAAAATCCTTGAAGG - Intronic
934885733 2:98022587-98022609 CTGAATATGCAAAGACATGGAGG - Intergenic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
937245269 2:120488485-120488507 AAGAATAGGAAGATCCATGGTGG - Intergenic
937669051 2:124519124-124519146 CAGAATAGGCAAATCCATAGAGG + Intronic
939117498 2:138077173-138077195 TTGAATATACAGATGCATGGGGG + Intergenic
940358615 2:152772575-152772597 CTGAATATCCAGATCCATTCTGG - Intergenic
940745152 2:157559621-157559643 TGGAATTAGCAGCTCCATGGGGG + Intronic
947036438 2:225863453-225863475 TTGAATAAACAAATTCATGGAGG + Intergenic
1172526755 20:35604427-35604449 CTGAATCGGCAGATCCAGAGTGG + Intergenic
1174983107 20:55419734-55419756 CTGATTCAGCAGGTGCATGGTGG - Intergenic
1183890532 22:40924245-40924267 CTGAAGTGGCAGAACCATGGGGG + Intronic
1184017055 22:41794237-41794259 CTGAACAAGCTGACCCAAGGAGG - Intronic
950347768 3:12313842-12313864 CTGAATAAGTAAATAAATGGGGG + Intronic
951587565 3:24231066-24231088 CTGAATAGCCAAATCCCTGGAGG - Intronic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959433263 3:106282012-106282034 TTGAATAAACAGATCCAAGTGGG - Intergenic
960988212 3:123294156-123294178 ATAAATAAGCAAATCAATGGAGG + Intronic
961189670 3:124948043-124948065 CAGAATAAGCAAATCCACAGAGG + Intronic
964543647 3:157807924-157807946 CTGATTCAGGAGATCCAGGGTGG - Intergenic
965464634 3:169012734-169012756 GTGATGAAGCAGATCCGTGGTGG + Intergenic
965501008 3:169456608-169456630 CTGATTCAGCAGGTCCGTGGTGG - Intronic
966451027 3:180062048-180062070 CTGAATAAGCACCGCCATGCTGG + Intergenic
966895141 3:184439329-184439351 GTGAATCAGCAGAGCAATGGAGG - Exonic
970983734 4:22130961-22130983 CTGAATGAGCTGCTTCATGGTGG + Intergenic
972648850 4:40995965-40995987 CATTAAAAGCAGATCCATGGCGG - Intronic
975069918 4:70121232-70121254 CTAAATATTCAGATACATGGAGG + Intergenic
981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG + Intronic
981218379 4:142200096-142200118 CTGAATAAGTAAATGAATGGAGG - Intronic
981537751 4:145817475-145817497 CTCAAGAAGCAGAATCATGGCGG + Intronic
983655384 4:170078523-170078545 CTGAATAAGCAGGTTCATCTAGG + Exonic
986213960 5:5700405-5700427 CTGGAGAAGAAGATCCTTGGAGG - Intergenic
988074144 5:26331178-26331200 CTAAATAAGCAAATCCATTATGG + Intergenic
988385207 5:30554040-30554062 CTGAATAATTAAATACATGGGGG - Intergenic
991154165 5:63410773-63410795 CAGAATAGGCAAATCCATAGAGG - Intergenic
993884801 5:93403273-93403295 CTCAATAAGCCAATCTATGGTGG - Intergenic
998100697 5:139431405-139431427 CAGAATAAGCAAATCTATAGAGG - Intronic
1000564213 5:162828026-162828048 GAGACTAAGCTGATCCATGGGGG - Intergenic
1004115554 6:12763531-12763553 TTTGATAAGCAGAACCATGGAGG - Intronic
1004204493 6:13579144-13579166 CTGGAAAAGCAGATACATGTTGG + Intronic
1007790674 6:44306517-44306539 CTGGATAAGCATCTCCCTGGGGG + Exonic
1008563245 6:52742599-52742621 CAGAATATGCAAATCCATAGAGG - Intergenic
1010787746 6:80024540-80024562 CAGAATAGGCAAATCCATAGAGG + Intronic
1011428966 6:87264707-87264729 CTGAAGAAGCAGATGGGTGGTGG + Intergenic
1012874462 6:104710263-104710285 CACAATAAGCAAATCTATGGAGG + Intergenic
1013499250 6:110731370-110731392 CTGGATAGGCAAATCCATAGAGG + Intronic
1013722504 6:113047631-113047653 TTGAATAAGGAGATATATGGTGG + Intergenic
1015593232 6:134842518-134842540 CTGGATCAGCAGATCCAGGCAGG + Intergenic
1017060432 6:150479345-150479367 CTGAATAAGCAAAGCCAGCGTGG - Intergenic
1017200400 6:151747314-151747336 CTGAATAAGCAGATGGGTTGTGG + Intronic
1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG + Intergenic
1022193787 7:28043923-28043945 CAGAAAAAGCAGATCCATAGAGG + Intronic
1022312728 7:29212466-29212488 CTGAATAAGCAGATCCATGGAGG - Intronic
1022392365 7:29954551-29954573 CAGAATAGGCAAATCCATAGAGG - Intronic
1026384824 7:69836023-69836045 CTGAAGAAACAGATAAATGGTGG - Intronic
1028698122 7:93741363-93741385 CTGAATAAGTAAATGAATGGAGG - Intronic
1029056545 7:97750845-97750867 CAGAATAGGCAAATCCATAGAGG + Intergenic
1029220571 7:98985992-98986014 CAGAATAAGCAAATCCATAGAGG - Intronic
1029243549 7:99181985-99182007 CTGGATCAGCTGATCCATGGTGG + Exonic
1031277426 7:119746278-119746300 GTGAAAAAGCAGTTCAATGGAGG + Intergenic
1035732573 8:1863215-1863237 CTGAACCAGCAGATGCATGTGGG + Intronic
1037133821 8:15438838-15438860 GTGAATATGCAGAGCCCTGGTGG + Intronic
1038309189 8:26432660-26432682 ATGGAAAAGCAGATCCATGCTGG + Intronic
1046062461 8:109155807-109155829 CTGTACAAGCAGATCCTTTGAGG - Intergenic
1048521734 8:135161792-135161814 CTGCATAACCAGAACCTTGGTGG + Intergenic
1048979881 8:139697503-139697525 GTGAATAAGCAGGTGCATGGAGG + Intronic
1053591455 9:39518478-39518500 CTGCAAATGCAGATTCATGGGGG + Intergenic
1053849299 9:42273837-42273859 CTGCAAATGCAGATTCATGGGGG + Intergenic
1054574852 9:66846811-66846833 CTGCAAATGCAGATTCATGGGGG - Intergenic
1056705870 9:88952443-88952465 CTGACTCAGCAGATCTAGGGTGG + Intergenic
1056905759 9:90646293-90646315 CTGAATCAACAGGTCCAGGGTGG - Intergenic
1056955740 9:91079698-91079720 CTGATTCAGCAGATCTAGGGGGG - Intergenic
1057292633 9:93816639-93816661 CAGAATAGGCAAATCCATAGAGG - Intergenic
1058421058 9:104833870-104833892 CTCAATCAGCAGATCCAGAGGGG + Intronic
1058865496 9:109158538-109158560 CAGAATAAGCAAATCCATAGAGG - Intronic
1059510076 9:114836861-114836883 CTGTATAAGAAGAGCCCTGGTGG + Intergenic
1060544285 9:124451226-124451248 CTGATGAAGCAGAACCTTGGCGG + Intergenic
1061140511 9:128763452-128763474 CTGAGTGAGCAGGTCCAGGGAGG - Intronic
1062158078 9:135065251-135065273 CTGAATAACAAGAACCATGCTGG + Intergenic
1185472825 X:394902-394924 CAGAACAGGCAAATCCATGGAGG - Intergenic
1186315409 X:8364618-8364640 CAGAATAAGCAAATGCATGAAGG - Intergenic
1186529604 X:10282062-10282084 CAGAAGAAGTACATCCATGGAGG - Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1189301724 X:39957130-39957152 CAGAATCAGGAGATCAATGGAGG + Intergenic
1189666203 X:43357521-43357543 CTTACTTAGCAGATCCATAGAGG - Intergenic
1189670981 X:43408372-43408394 CTGGATAAGCAGATCCATGGCGG + Intergenic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1190451324 X:50584119-50584141 CTGAATCAGAAGATTCATGATGG + Intergenic
1191873820 X:65773445-65773467 CTGAATAAGCAGATCCATGGAGG + Intergenic
1192222284 X:69205601-69205623 CTGATTCAGCAGATCTAGGGTGG + Intergenic
1192332645 X:70190162-70190184 ATGAAAAAGCAATTCCATGGAGG + Intronic
1194788424 X:98116015-98116037 TTGAATCAGCAAAGCCATGGGGG - Intergenic
1194861312 X:99001847-99001869 CTGAATTTTCATATCCATGGTGG - Intergenic
1195413882 X:104599208-104599230 ATGAATGAGCAAATCCATGTGGG + Intronic
1196893211 X:120309916-120309938 CTGAATATGCAAAACCATTGAGG + Intronic
1197881777 X:131174278-131174300 TAGAATAGGCAAATCCATGGAGG + Intergenic
1197939561 X:131775440-131775462 CTGAATAAGAAAAACCAAGGTGG - Intergenic
1198318354 X:135493220-135493242 CTGAATATGCAGATCAATTTGGG - Intergenic
1199731094 X:150632779-150632801 CTGGATAACCAGACCGATGGTGG + Intronic
1200337089 X:155362265-155362287 CTGACTTAGCAGATCCAAGAAGG + Intergenic
1200349381 X:155478962-155478984 CTGACTTAGCAGATCCAAGAAGG - Intergenic
1201189845 Y:11436826-11436848 CAGAACAGGCAGACCCATGGTGG - Intergenic
1201917675 Y:19199761-19199783 CTGAATAAGAAAATCCTTGACGG + Intergenic