ID: 1191877867

View in Genome Browser
Species Human (GRCh38)
Location X:65814056-65814078
Sequence CAGTTGTGGTGGAGGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191877867_1191877872 -9 Left 1191877867 X:65814056-65814078 CCCTTTGTCCTCCACCACAACTG No data
Right 1191877872 X:65814070-65814092 CCACAACTGTAAGTTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191877867 Original CRISPR CAGTTGTGGTGGAGGACAAA GGG (reversed) Intergenic
No off target data available for this crispr