ID: 1191878549

View in Genome Browser
Species Human (GRCh38)
Location X:65821923-65821945
Sequence CTGGAGATACATGGTTTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191878549 Original CRISPR CTGGAGATACATGGTTTAAA TGG Intergenic
902380486 1:16050203-16050225 ATGGGCACACATGGTTTAAAGGG - Intronic
905311405 1:37051642-37051664 GTGGAGGTAGATGGGTTAAAAGG - Intergenic
905676630 1:39830488-39830510 CTCGGGATTCATGGTTTACAGGG + Intergenic
906126161 1:43428158-43428180 CGGGAGATACAGGGATTACAGGG + Intronic
907930614 1:58995895-58995917 CTGGATTTGCATGTTTTAAAGGG + Intergenic
908299199 1:62745268-62745290 CTGGAGATATAGGGATGAAATGG + Intergenic
908331615 1:63076380-63076402 CTGGAGATACAGTGTTGAATAGG + Intergenic
909638360 1:77843606-77843628 CTGTAAACACATGGTTTAGATGG + Intronic
911387981 1:97201591-97201613 CTGGAGATACATAGTAAATAGGG + Intronic
911925652 1:103828372-103828394 CTGGAGATAAATGGTGGTAATGG - Intergenic
912844329 1:113065951-113065973 CTGGAGATAGATGGTGGCAATGG - Intergenic
915104006 1:153521207-153521229 CTTAAGATACTTGGTTTTAATGG - Intergenic
915612510 1:157005730-157005752 CTTGAAATAAATGGTTTGAATGG - Intronic
920505323 1:206511616-206511638 TTGGAATTACATGGTTGAAAGGG + Intronic
921070703 1:211655574-211655596 CTGGAGAAACATCGTTTGGAAGG + Intergenic
1063877280 10:10493343-10493365 CTGGAGATGCATGGTGGAGACGG + Intergenic
1065386137 10:25135020-25135042 CTGGAGATGGATGGTGTTAATGG - Intergenic
1065459418 10:25941691-25941713 CTGGAGATGGATGGTGTTAAAGG - Intronic
1065999908 10:31094839-31094861 CTCTACATACCTGGTTTAAAAGG + Intergenic
1066803142 10:39212291-39212313 ATGGAGATACATGGTGAAAAAGG - Intergenic
1068883972 10:62079551-62079573 CTGGAGTTACATGGATTTCAGGG - Intronic
1069447177 10:68484198-68484220 CTGGATATACATCCTTTAAAAGG - Intronic
1070270956 10:74954384-74954406 CTGGAGATAAATGGTGGTAATGG + Intronic
1070353006 10:75611438-75611460 CTGGAGATGGATGGTTGTAACGG - Intronic
1072649808 10:97286236-97286258 TTCGAGAAAAATGGTTTAAAAGG - Intronic
1073078554 10:100840502-100840524 CTAGACATACATTTTTTAAAAGG + Intergenic
1074353659 10:112762261-112762283 CTGTAGCTACAAGGTGTAAAGGG + Intronic
1080040614 11:27755860-27755882 CTGGAGATAGATGGTGGTAATGG - Intergenic
1080692736 11:34572268-34572290 AAGTAGATACATGTTTTAAAGGG - Intergenic
1081987697 11:47318526-47318548 CTGGAGATATTTTTTTTAAAAGG - Intronic
1082687951 11:56262409-56262431 CTGTAGAAACATGGATTTAAAGG - Intergenic
1084805507 11:71576269-71576291 GAGGAGAAACATGGTTTGAAAGG + Intergenic
1085955612 11:81390163-81390185 TTGGAAAACCATGGTTTAAATGG + Intergenic
1087937583 11:104052834-104052856 TTGGAGATACAAATTTTAAAAGG - Intronic
1088008164 11:104967429-104967451 CTGGATACACATGTTTCAAAAGG + Intronic
1092150450 12:6244674-6244696 CTGGACAGCCCTGGTTTAAAGGG - Intergenic
1093081374 12:14815463-14815485 CTGGTGATACAGGGTGTAAGTGG + Intronic
1093426536 12:19034622-19034644 CTGGAGATCCACAGTTTTAAGGG + Intergenic
1093767346 12:22980246-22980268 CTGGAGCTGAATGGTCTAAATGG + Intergenic
1094299823 12:28950596-28950618 CTGGAGCTACATGGTGATAATGG - Intergenic
1095414214 12:41958376-41958398 CTAAAAATACATGTTTTAAAAGG - Intergenic
1097801589 12:63920418-63920440 CTGGAGATACAAGGTTGGGAAGG + Intronic
1099124107 12:78730935-78730957 GAGGAGAAACATGGTTTGAAAGG + Intergenic
1104271669 12:127287890-127287912 CTGGGGAAACCTGGATTAAAAGG + Intergenic
1105943219 13:25169852-25169874 CTGGAGATACGGGCTTTAACCGG + Exonic
1107604697 13:42046271-42046293 TTTGAGCTACATGGTTGAAATGG + Intronic
1108198431 13:48018436-48018458 CTGGAGATAGATGGTAGTAATGG - Intergenic
1109162688 13:58995091-58995113 CTTGAGAAAAATGGTCTAAAGGG - Intergenic
1110108055 13:71704637-71704659 CTGTGGATTCATGGCTTAAAAGG + Intronic
1110139840 13:72114903-72114925 CAGGAGAGACATGTTTCAAAAGG + Intergenic
1110242029 13:73279117-73279139 CTTGAGATACATACTTTAAATGG + Intergenic
1113291307 13:108909806-108909828 CTGAAAAGACATGGTTTAAGGGG - Intronic
1114043110 14:18697483-18697505 CATTAGATAAATGGTTTAAATGG + Intergenic
1114047401 14:18887923-18887945 CATTAGATAAATGGTTTAAATGG + Intergenic
1114116813 14:19631478-19631500 CATTAGATAAATGGTTTAAATGG - Intergenic
1114126692 14:19735625-19735647 ATGGCGATTCATGTTTTAAAGGG + Intronic
1114574103 14:23696749-23696771 CTAGAGTTACCAGGTTTAAAGGG - Intergenic
1116427703 14:44810477-44810499 CTGGAGATGCTTTGCTTAAATGG - Intergenic
1117009291 14:51453947-51453969 CTGGAGACACATGCTTTAAGAGG + Intergenic
1118629143 14:67687078-67687100 CTGGAGATGCATGCTTTAGGTGG - Intronic
1119825032 14:77650559-77650581 CTGGAGATACAACTTTTAAACGG - Intergenic
1120502621 14:85315722-85315744 CTGGATCTCCATGGTTTGAATGG - Intergenic
1122724574 14:103741857-103741879 CTGGAGGTACATGGAGTATATGG + Exonic
1126257934 15:46650175-46650197 CTGGATATAAATATTTTAAAAGG + Intergenic
1126409206 15:48354661-48354683 CTGCAGCTACATGTTTGAAATGG + Intergenic
1128205550 15:65848666-65848688 CTGTAGATATATGATTTGAAAGG + Intronic
1129540675 15:76345238-76345260 CTGCCAATACAGGGTTTAAATGG + Intergenic
1131060754 15:89402987-89403009 CAGGAGAGACAAGGTTTCAAGGG - Intergenic
1133072771 16:3257367-3257389 CTGGAGCTACACGGGTGAAAAGG + Intergenic
1133174282 16:4002111-4002133 CTGGAGTTATATACTTTAAATGG - Intronic
1133919519 16:10139627-10139649 CTGGGGATACCTTGTTAAAAAGG + Intronic
1136281440 16:29213772-29213794 CTGGAACTGCATGCTTTAAATGG + Intergenic
1137244537 16:46691380-46691402 TTGGAAATACGTGCTTTAAAAGG - Intronic
1141730966 16:85822599-85822621 CTGGAAATACCCGGTTTTAAAGG + Intergenic
1145741886 17:27281576-27281598 CTGGAGGGAGATGATTTAAAAGG - Intergenic
1145806020 17:27731051-27731073 CATTAGATAAATGGTTTAAATGG - Intergenic
1149282835 17:55127423-55127445 CTGGGGATGCATGTTTTCAATGG + Intronic
1149956949 17:61062199-61062221 CATGATATACACGGTTTAAAAGG + Intronic
1150045665 17:61910825-61910847 CTGGAGATATATGCTTTCAGGGG + Intronic
1152448715 17:80362836-80362858 CTTGAAAAACATGGTTTTAATGG - Intronic
1153752888 18:8251676-8251698 CTGGGGATGCATGGTATGAAAGG - Intronic
1158676201 18:59520717-59520739 TTGGATATACATGGTTCAGATGG - Intronic
1163931493 19:20397569-20397591 CTGGAGAGAAATGCTATAAATGG - Intergenic
1164069272 19:21751161-21751183 CTGGAGATAGATGATTTAAGTGG - Intronic
1164671656 19:30076072-30076094 ATGGAGAGACATGGTTGAATAGG + Intergenic
1164913933 19:32034736-32034758 CTTGAAATACATGGTTTCACTGG - Intergenic
925128883 2:1480722-1480744 CAGGAGAAACATGGTTTGGACGG - Intronic
925626161 2:5843688-5843710 CTGGAAATAAATAGATTAAAAGG - Intergenic
926865686 2:17355804-17355826 CTGTAGATACATGAGTCAAAAGG - Intergenic
927241352 2:20922333-20922355 CTGGTGATACATAATTGAAATGG + Intergenic
927474032 2:23398517-23398539 CTGGAGATAGATGGTGGAGAAGG + Intronic
929349146 2:40927360-40927382 ATGGAGTTACATAGTTTCAATGG + Intergenic
930205371 2:48582375-48582397 CTGGAGGTTCATGGTCCAAAGGG - Exonic
941992421 2:171570062-171570084 CAGGAGATACAATGTTTAAGGGG + Intergenic
943679513 2:190753162-190753184 CTGGAGATCCAAAGTTCAAAAGG + Intergenic
945814325 2:214585480-214585502 TTGGATATACATAGTATAAAAGG + Intergenic
945828037 2:214748762-214748784 CTGGAGATCACTGATTTAAAGGG + Intronic
946847687 2:223874301-223874323 TTAGAGATACATTGTTTTAATGG - Intronic
1177310659 21:19388105-19388127 CTGGAAATAAATGTTATAAAGGG + Intergenic
1177917698 21:27111008-27111030 CTGAAGAAACATGGGTTCAAGGG - Intergenic
1178253042 21:31023040-31023062 TTGGAAATACATGGTTAATATGG - Intergenic
1179128334 21:38612009-38612031 CTTGAGAAAAATGATTTAAAAGG - Intronic
1180465935 22:15610578-15610600 CATTAGATAAATGGTTTAAATGG + Intergenic
1185026073 22:48413740-48413762 CAGGAGACAAATGGTTTGAATGG + Intergenic
1185115042 22:48929192-48929214 CCGGAGACACCTGCTTTAAAGGG - Intergenic
949761663 3:7477786-7477808 CTGGAGATACAGGCTTCACAAGG - Intronic
951630726 3:24717066-24717088 AGGGAGGTACATGGTTTAAGGGG - Intergenic
952690704 3:36201865-36201887 CTGGAAATAGATTGTTAAAAAGG - Intergenic
952790213 3:37194373-37194395 CTGGAGTCCCATGGTTGAAATGG + Intergenic
955487130 3:59446664-59446686 CTGGAAATAGATGTTTTTAAAGG + Intergenic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
958070676 3:88607055-88607077 CTGGAGAAAAAATGTTTAAAAGG - Intergenic
960215819 3:115036137-115036159 CTGGAGATACTTGGTGGTAATGG + Intronic
960313464 3:116146232-116146254 CAGGAGATACATGTTTTATAGGG - Intronic
962020217 3:131492299-131492321 ATGGAGATAAATGCTTTGAAGGG - Intronic
962209106 3:133461572-133461594 CTGGAGGCACAGGGTTGAAATGG + Intronic
963179302 3:142337418-142337440 CTGGGGATACATGACTAAAAAGG - Intronic
970971770 4:21992396-21992418 CTTGAGATCCATGCTTTAACAGG + Intergenic
971446819 4:26759221-26759243 CTAGAGATATATGGCTGAAAAGG - Intergenic
971826111 4:31624883-31624905 CTGGAGTTAGAAGGTTCAAAAGG + Intergenic
972247446 4:37260065-37260087 CTGATGGTACATGATTTAAATGG - Intronic
975883763 4:78940797-78940819 GTGGAGAAACATGATTGAAAGGG + Intergenic
976386726 4:84468192-84468214 TTGGAGAAAGATGCTTTAAAGGG - Intergenic
976483337 4:85570443-85570465 CTGGAGAAGAGTGGTTTAAAAGG + Intronic
981466204 4:145075688-145075710 CTGGAGATACATGGTGAGAGTGG - Intronic
981932799 4:150208930-150208952 CAGCAGATACATGGGTTACAAGG + Intronic
982901832 4:161014789-161014811 CTGTGTATACATAGTTTAAAGGG - Intergenic
983186701 4:164708831-164708853 CTTCAGAGACATGGATTAAAAGG + Intergenic
983353117 4:166619883-166619905 CTGGAGATAGATGGTAGTAATGG + Intergenic
985835132 5:2265040-2265062 AAAGAAATACATGGTTTAAATGG + Intergenic
986110167 5:4708416-4708438 CTGGAGATATAATGTTGAAAAGG - Intergenic
987313444 5:16702004-16702026 TTGGAGATACAGCTTTTAAAGGG + Intronic
987992532 5:25232598-25232620 TTGGAGATACAGTCTTTAAAGGG - Intergenic
988434700 5:31160208-31160230 CTGGAGCTTCATGGTCTCAAAGG - Intergenic
989826905 5:45867775-45867797 CTGGAGATTCATGCTTTTGAAGG + Intergenic
990698923 5:58454344-58454366 CTTGAGATACCTGTTTTAAAAGG - Exonic
990943090 5:61223341-61223363 TTGGAAAAACATGTTTTAAAAGG + Intergenic
990957881 5:61361979-61362001 ATGGAAATAGGTGGTTTAAATGG + Intronic
993248633 5:85485756-85485778 CAAGAGATACATTGTTTAGAAGG + Intergenic
993553948 5:89312359-89312381 CTGCAGTGACATGTTTTAAATGG + Intergenic
994215859 5:97136337-97136359 CAGAAGATAAATGGCTTAAAAGG + Intronic
994319581 5:98377344-98377366 CTGGAGATACATTATTTATTGGG - Intergenic
995121604 5:108541451-108541473 CTGGAGATAGATAGTGTTAATGG + Intergenic
995399529 5:111724927-111724949 CTGGTGATACGGGTTTTAAAAGG - Intronic
996641061 5:125754002-125754024 CTGGAGATACCTGATCCAAATGG - Intergenic
996671156 5:126119294-126119316 CCGGAGATACAACGATTAAAGGG + Intergenic
998314298 5:141167073-141167095 CTGGGGAAACATTGTTCAAAAGG + Intergenic
1000425422 5:161084794-161084816 TTTGAGATTCATGGTTTAAAAGG + Intergenic
1001878771 5:175224230-175224252 CAGGAGAGAAATGTTTTAAATGG - Intergenic
1003530647 6:6934810-6934832 CTTCATATACATGTTTTAAAAGG + Intergenic
1004411618 6:15386347-15386369 CTGGAGATATGTGGTTTCACAGG - Intronic
1005234972 6:23749707-23749729 ATGGAGAAATATGGATTAAAGGG - Intergenic
1007904758 6:45448468-45448490 CTAGAGGAACATGGTTTAAAAGG + Intronic
1008326146 6:50184533-50184555 CTGGAACTACATGGTTGGAATGG - Intergenic
1009843460 6:69106307-69106329 CTGGAAATGCATGGTTGGAATGG - Intronic
1010278299 6:73994210-73994232 CTGCAGATACATCCTTAAAATGG - Intergenic
1013798338 6:113910458-113910480 CTTGAGAGAGATGGTTCAAAGGG - Intergenic
1013959869 6:115887064-115887086 CTTGGGATATATTGTTTAAAAGG - Intergenic
1014174424 6:118315961-118315983 ATGGAGTTACAGGGTTTATAGGG + Exonic
1016486450 6:144544918-144544940 CTAGAGCTACATGCTTCAAAAGG - Intronic
1016495628 6:144658673-144658695 CTAGAGAAACATGTTTCAAATGG + Intronic
1016819262 6:148332559-148332581 TTTGAGATACTTGGTTTTAAAGG - Intronic
1017318118 6:153056006-153056028 TGGGAGAAACATGGTTTAACAGG + Intronic
1024122443 7:46258221-46258243 CTGGAGATACTTGGCAGAAAAGG - Intergenic
1024794639 7:53006959-53006981 ATTAAGATACATGATTTAAAGGG + Intergenic
1024917034 7:54513525-54513547 TTGAAGATAAATGGCTTAAATGG - Intergenic
1026085710 7:67261312-67261334 CTTTAGATTCAGGGTTTAAATGG + Intergenic
1026691457 7:72553571-72553593 CTTTAGATTCAGGGTTTAAATGG - Intergenic
1027559405 7:79708395-79708417 CTGGAGAAAGATGGTTTTAGAGG - Intergenic
1028274707 7:88840365-88840387 CTGGATAAATATGTTTTAAATGG + Intronic
1028709009 7:93886142-93886164 ATAGAGATAGATGGTTTTAAGGG - Exonic
1028736622 7:94220379-94220401 CTGCAAATACCTGGTTTAGAAGG + Intergenic
1033463698 7:141571135-141571157 CTGGAGATAAATATTTTAATAGG - Intronic
1033502228 7:141963314-141963336 CTGGAGTGACATGGTTTCTAAGG + Intronic
1038656935 8:29461418-29461440 TTGATGATACATGGTGTAAAAGG - Intergenic
1046380798 8:113447503-113447525 TTGAAGATACATTTTTTAAATGG - Intergenic
1047018586 8:120750220-120750242 CTGGAGATACAAAGGTTTAAGGG - Intronic
1047052913 8:121132904-121132926 CTGGACTTATATAGTTTAAATGG + Intergenic
1047170070 8:122484104-122484126 CTGGAGAGAGATGCTTTAAAAGG - Intergenic
1047980691 8:130178613-130178635 GTGGAAATACATGGTGCAAATGG + Intronic
1050285265 9:4095255-4095277 CTGGACATAAATGTTTTAACCGG + Intronic
1050599364 9:7234991-7235013 CTGGAGATACCTGGTTTTTAAGG - Intergenic
1052543442 9:29841678-29841700 GTGCAGATACCTGGTTTAATAGG - Intergenic
1052802606 9:32983913-32983935 CTGGAGATAGATGGTAGTAATGG + Intronic
1052975782 9:34408928-34408950 CTGGAGGTACTGGGTATAAATGG + Intronic
1054873660 9:70073239-70073261 CTGAAAATACGTGGTTTAAAAGG + Intronic
1056691174 9:88809822-88809844 TTGGAAAAACATGATTTAAATGG + Intergenic
1056760304 9:89409770-89409792 TTGGAGAGATATGGTTTACATGG + Intronic
1058639193 9:107066614-107066636 CTTTAGAAACATGGTTCAAATGG + Intergenic
1060425451 9:123501022-123501044 CTGGAGATAGATGGTGATAATGG - Intronic
1060835377 9:126751729-126751751 ATGGAGATACATGCTTGGAAAGG + Intergenic
1186046714 X:5544532-5544554 CTTCTGTTACATGGTTTAAAGGG - Intergenic
1187394214 X:18906042-18906064 AAGCAGATACATGATTTAAACGG - Intronic
1188987450 X:36780207-36780229 CTGGAAGTTCTTGGTTTAAATGG - Intergenic
1191878549 X:65821923-65821945 CTGGAGATACATGGTTTAAATGG + Intergenic
1194636912 X:96356745-96356767 CTGGAGATAAATAGTTGTAATGG + Intergenic
1194916980 X:99719269-99719291 CAGGAGAAACATGTTTTAACTGG + Intergenic
1195858343 X:109354791-109354813 ATGAAGATTCATGGTTTACAGGG + Intergenic
1198110588 X:133499390-133499412 CTGGAGCTTAATGGTTTAAAAGG - Intergenic
1199966979 X:152828771-152828793 CTCGAGTTACATTGTTAAAAAGG - Intronic