ID: 1191880801

View in Genome Browser
Species Human (GRCh38)
Location X:65842261-65842283
Sequence CTCTAAAACCAGAAGCTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191880798_1191880801 15 Left 1191880798 X:65842223-65842245 CCAGTTATGGAGGAGGCTGTTTT No data
Right 1191880801 X:65842261-65842283 CTCTAAAACCAGAAGCTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191880801 Original CRISPR CTCTAAAACCAGAAGCTATA AGG Intergenic
No off target data available for this crispr