ID: 1191880879

View in Genome Browser
Species Human (GRCh38)
Location X:65842881-65842903
Sequence TTGAAATAGGAGTCGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191880879_1191880882 14 Left 1191880879 X:65842881-65842903 CCTTGTTCCGACTCCTATTTCAA No data
Right 1191880882 X:65842918-65842940 TTAATTTTTTAGCCATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191880879 Original CRISPR TTGAAATAGGAGTCGGAACA AGG (reversed) Intergenic
No off target data available for this crispr