ID: 1191885434

View in Genome Browser
Species Human (GRCh38)
Location X:65883257-65883279
Sequence GCCTCCTAAAGAAAAATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191885431_1191885434 23 Left 1191885431 X:65883211-65883233 CCAAATAACTTTCAATGCAGCAC No data
Right 1191885434 X:65883257-65883279 GCCTCCTAAAGAAAAATCCAAGG No data
1191885430_1191885434 24 Left 1191885430 X:65883210-65883232 CCCAAATAACTTTCAATGCAGCA No data
Right 1191885434 X:65883257-65883279 GCCTCCTAAAGAAAAATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191885434 Original CRISPR GCCTCCTAAAGAAAAATCCA AGG Intergenic
No off target data available for this crispr