ID: 1191885742

View in Genome Browser
Species Human (GRCh38)
Location X:65886122-65886144
Sequence GACATCAGTACAGCCTGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191885742_1191885745 11 Left 1191885742 X:65886122-65886144 CCAACTCAGGCTGTACTGATGTC No data
Right 1191885745 X:65886156-65886178 ACAATGTGGTTTGCTTTAAATGG No data
1191885742_1191885744 -3 Left 1191885742 X:65886122-65886144 CCAACTCAGGCTGTACTGATGTC No data
Right 1191885744 X:65886142-65886164 GTCTCAGTGGTCTCACAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191885742 Original CRISPR GACATCAGTACAGCCTGAGT TGG (reversed) Intergenic