ID: 1191888281

View in Genome Browser
Species Human (GRCh38)
Location X:65912639-65912661
Sequence GAGCTGAAGGCCATTATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191888281_1191888287 17 Left 1191888281 X:65912639-65912661 CCAATAATAATGGCCTTCAGCTC No data
Right 1191888287 X:65912679-65912701 AAGACATTATCTCTTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191888281 Original CRISPR GAGCTGAAGGCCATTATTAT TGG (reversed) Intergenic
No off target data available for this crispr