ID: 1191891583

View in Genome Browser
Species Human (GRCh38)
Location X:65948541-65948563
Sequence CAGTATCAGAAGAAGAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191891583_1191891586 -5 Left 1191891583 X:65948541-65948563 CCCCTTTTCTTCTTCTGATACTG No data
Right 1191891586 X:65948559-65948581 TACTGACATTACACATATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191891583 Original CRISPR CAGTATCAGAAGAAGAAAAG GGG (reversed) Intergenic
No off target data available for this crispr