ID: 1191892759

View in Genome Browser
Species Human (GRCh38)
Location X:65961542-65961564
Sequence TCCCTTGTCCTGTTATTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191892756_1191892759 -2 Left 1191892756 X:65961521-65961543 CCTTGGGAAAGTGTCAGAATGTC No data
Right 1191892759 X:65961542-65961564 TCCCTTGTCCTGTTATTGGGTGG No data
1191892753_1191892759 15 Left 1191892753 X:65961504-65961526 CCATTTCATGTTAAGAGCCTTGG No data
Right 1191892759 X:65961542-65961564 TCCCTTGTCCTGTTATTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191892759 Original CRISPR TCCCTTGTCCTGTTATTGGG TGG Intergenic
No off target data available for this crispr