ID: 1191894135

View in Genome Browser
Species Human (GRCh38)
Location X:65975196-65975218
Sequence CCCAACAGCTCATTGAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2279
Summary {0: 1398, 1: 571, 2: 139, 3: 41, 4: 130}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191894135_1191894146 11 Left 1191894135 X:65975196-65975218 CCTGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1191894146 X:65975230-65975252 TCCCAGACGGGGTGGCGGCGGGG 0: 47
1: 1519
2: 3499
3: 3764
4: 5154
1191894135_1191894138 -1 Left 1191894135 X:65975196-65975218 CCTGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1191894138 X:65975218-65975240 GTACACCTCACCTCCCAGACGGG No data
1191894135_1191894140 3 Left 1191894135 X:65975196-65975218 CCTGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1191894140 X:65975222-65975244 ACCTCACCTCCCAGACGGGGTGG No data
1191894135_1191894150 18 Left 1191894135 X:65975196-65975218 CCTGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1191894150 X:65975237-65975259 CGGGGTGGCGGCGGGGCAGAGGG No data
1191894135_1191894151 19 Left 1191894135 X:65975196-65975218 CCTGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1191894151 X:65975238-65975260 GGGGTGGCGGCGGGGCAGAGGGG 0: 6
1: 297
2: 1350
3: 1531
4: 2710
1191894135_1191894142 6 Left 1191894135 X:65975196-65975218 CCTGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1191894142 X:65975225-65975247 TCACCTCCCAGACGGGGTGGCGG 0: 217
1: 3226
2: 2485
3: 1719
4: 2406
1191894135_1191894137 -2 Left 1191894135 X:65975196-65975218 CCTGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1191894137 X:65975217-65975239 GGTACACCTCACCTCCCAGACGG No data
1191894135_1191894144 9 Left 1191894135 X:65975196-65975218 CCTGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1191894144 X:65975228-65975250 CCTCCCAGACGGGGTGGCGGCGG 0: 46
1: 66
2: 54
3: 81
4: 348
1191894135_1191894139 0 Left 1191894135 X:65975196-65975218 CCTGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1191894139 X:65975219-65975241 TACACCTCACCTCCCAGACGGGG No data
1191894135_1191894145 10 Left 1191894135 X:65975196-65975218 CCTGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1191894145 X:65975229-65975251 CTCCCAGACGGGGTGGCGGCGGG 0: 371
1: 2903
2: 3254
3: 2334
4: 3126
1191894135_1191894149 17 Left 1191894135 X:65975196-65975218 CCTGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1191894149 X:65975236-65975258 ACGGGGTGGCGGCGGGGCAGAGG 0: 18
1: 1456
2: 2564
3: 2617
4: 3326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191894135 Original CRISPR CCCAACAGCTCATTGAGAAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr