ID: 1191894141

View in Genome Browser
Species Human (GRCh38)
Location X:65975223-65975245
Sequence GCCACCCCGTCTGGGAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25165
Summary {0: 347, 1: 3636, 2: 6174, 3: 6475, 4: 8533}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191894141_1191894150 -9 Left 1191894141 X:65975223-65975245 CCTCACCTCCCAGACGGGGTGGC 0: 347
1: 3636
2: 6174
3: 6475
4: 8533
Right 1191894150 X:65975237-65975259 CGGGGTGGCGGCGGGGCAGAGGG No data
1191894141_1191894157 20 Left 1191894141 X:65975223-65975245 CCTCACCTCCCAGACGGGGTGGC 0: 347
1: 3636
2: 6174
3: 6475
4: 8533
Right 1191894157 X:65975266-65975288 CACTTCCCAGACGGGGTGGCTGG 0: 78
1: 725
2: 3435
3: 7510
4: 3424
1191894141_1191894149 -10 Left 1191894141 X:65975223-65975245 CCTCACCTCCCAGACGGGGTGGC 0: 347
1: 3636
2: 6174
3: 6475
4: 8533
Right 1191894149 X:65975236-65975258 ACGGGGTGGCGGCGGGGCAGAGG 0: 18
1: 1456
2: 2564
3: 2617
4: 3326
1191894141_1191894155 16 Left 1191894141 X:65975223-65975245 CCTCACCTCCCAGACGGGGTGGC 0: 347
1: 3636
2: 6174
3: 6475
4: 8533
Right 1191894155 X:65975262-65975284 TCCTCACTTCCCAGACGGGGTGG 0: 2450
1: 5586
2: 7438
3: 5479
4: 3157
1191894141_1191894154 13 Left 1191894141 X:65975223-65975245 CCTCACCTCCCAGACGGGGTGGC 0: 347
1: 3636
2: 6174
3: 6475
4: 8533
Right 1191894154 X:65975259-65975281 GGCTCCTCACTTCCCAGACGGGG 0: 287
1: 4191
2: 9288
3: 5724
4: 3879
1191894141_1191894161 27 Left 1191894141 X:65975223-65975245 CCTCACCTCCCAGACGGGGTGGC 0: 347
1: 3636
2: 6174
3: 6475
4: 8533
Right 1191894161 X:65975273-65975295 CAGACGGGGTGGCTGGGCAGAGG 0: 29
1: 329
2: 1436
3: 2447
4: 5078
1191894141_1191894151 -8 Left 1191894141 X:65975223-65975245 CCTCACCTCCCAGACGGGGTGGC 0: 347
1: 3636
2: 6174
3: 6475
4: 8533
Right 1191894151 X:65975238-65975260 GGGGTGGCGGCGGGGCAGAGGGG 0: 6
1: 297
2: 1350
3: 1531
4: 2710
1191894141_1191894153 12 Left 1191894141 X:65975223-65975245 CCTCACCTCCCAGACGGGGTGGC 0: 347
1: 3636
2: 6174
3: 6475
4: 8533
Right 1191894153 X:65975258-65975280 GGGCTCCTCACTTCCCAGACGGG 0: 286
1: 2796
2: 9084
3: 7841
4: 5698
1191894141_1191894152 11 Left 1191894141 X:65975223-65975245 CCTCACCTCCCAGACGGGGTGGC 0: 347
1: 3636
2: 6174
3: 6475
4: 8533
Right 1191894152 X:65975257-65975279 GGGGCTCCTCACTTCCCAGACGG 0: 534
1: 6035
2: 7253
3: 5360
4: 4231
1191894141_1191894158 21 Left 1191894141 X:65975223-65975245 CCTCACCTCCCAGACGGGGTGGC 0: 347
1: 3636
2: 6174
3: 6475
4: 8533
Right 1191894158 X:65975267-65975289 ACTTCCCAGACGGGGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191894141 Original CRISPR GCCACCCCGTCTGGGAGGTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr