ID: 1191894150

View in Genome Browser
Species Human (GRCh38)
Location X:65975237-65975259
Sequence CGGGGTGGCGGCGGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191894141_1191894150 -9 Left 1191894141 X:65975223-65975245 CCTCACCTCCCAGACGGGGTGGC 0: 347
1: 3636
2: 6174
3: 6475
4: 8533
Right 1191894150 X:65975237-65975259 CGGGGTGGCGGCGGGGCAGAGGG No data
1191894135_1191894150 18 Left 1191894135 X:65975196-65975218 CCTGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1191894150 X:65975237-65975259 CGGGGTGGCGGCGGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191894150 Original CRISPR CGGGGTGGCGGCGGGGCAGA GGG Intergenic
No off target data available for this crispr